Previous Contig 009147:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D02Sequence792009147 (16)gb:BT001001_16352567e-84Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF020B08Sequence569009147 (16)gb:BT001001_16352566e-71Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726773009147 (16)gb:BT001001_16352561e-67Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF023E12Sequence514009147 (16)gb:BT001001_16352561e-58Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726772009147 (16)gb:BT001001_16352568e-77Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF034A16Sequence499009147 (16)gb:BT001001_16352562e-50Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726496009147 (16)gb:BT001001_16352567e-31Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF034O21Sequence668009147 (16)gb:BT001001_16352566e-75Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF034P09Sequence434009147 (16)gb:BT001001_16352564e-50Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF035K22Sequence544009147 (16)gb:BT001001_16352563e-60Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726718009147 (16)gb:BT001001_16352564e-81Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF035L10Sequence568009147 (16)gb:BT001001_16352562e-56Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFF050O13Sequence606009147 (16)gb:BT001001_16352562e-75Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726568009147 (16)gb:BT001001_16352567e-50Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMFN043L12Sequence504009147 (16)gb:BT001001_16352563e-44Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726
JMSF050A14Sequence595007416 (4)gb:BT010763_16407091e-54Arabidopsis thaliana At5g27490 gene, complete cds.>gb:BT010990_1640936 Arabidops251009147 (16)gb:BT001001_16352569e-29Arabidopsis thaliana At3g62580/T12C14_280 mRNA, complete cds.>gb:AF411796_179726

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF034A16- GCGCTTA
JMFF035K22- A
                      ____________________________________________________________
consensus GCGCTTA
 
. : . : . : . : . : . :
JMFF034A16- TGTTAGCTGCAGCGTTGAAGTGGAAGAAGTAGTTGAAGCAAAGCACTTGACTTTTCCGAT
JMFF023E12- GGAAGAAGTAGTTGAAGCAAAGCACTTGACTTTTCCGAT
JMFF035K22- TGTTAGCTGCAGCGTTGAAGTGGAAGAAGTAGTTGAAGCAAAGCACTTGACTTTTCCGAT
JMFF020B08- AGTTGAAGCAAAGCACTTGACTTTTCCGAT
JMFF050O13- TGAAGCAAAGCACTTGACTTTTCCGAT
                      ____________________________________________________________
consensus TGTTAGCTGCAGCGTTGAAGTGGAAGAAGTAGTTGAAGCAAAGCACTTGACTTTTCCGAT
 
. : . : . : . : . : . :
JMFF034A16- TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
JMFF023E12- TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
JMFF035K22- TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
JMFF020B08- TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
JMFF050O13- TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
rJMFF017D02+ GGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
                      ____________________________________________________________
consensus TCCAACTATCAGCTTCTAGTTTTCCGGCGACTTCCTGCGCTCTGTAGAGATGGGGTGGAT
 
. : . : . : . : . : . :
JMFF034A16- GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
JMFF023E12- GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
JMFF035K22- GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
JMFF020B08- GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
JMFF050O13- GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
rJMFF035K22+ CTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
rJMFF034O21+ CGGAAA
rJMFF017D02+ GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
rJMFF023E12+ TTAGCGATCGGAGTGGTGTTTTCCCCCGGAAA
                      ____________________________________________________________
consensus GTCTCGATTCTCAACAGTTCTTGCTTTCTTAGCGATCGGAGTGGTGTTTT-CACCGGAAA
 
. : . : . : . : . : . :
JMFF034A16- CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
JMFF023E12- NTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
JMFF035K22- CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
JMFF020B08- CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
JMFF050O13- CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
rJMFF035K22+ CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
rJMFF034O21+ CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
rJMFF017D02+ CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
rJMFF023E12+ CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
rJMFF020B08+ GGATCAAAATCCGACGGTCAGTATCNTNTCAAGACCGTCACTTTTTNTGAAATTA
                      ____________________________________________________________
consensus CTTTTGGATCAAAATCCGACGGTCAGTATCCTCTCAAGACCGTCAC-TTTTCTGAAATTA
 
. : . : . : . : . : . :
JMFF034A16- GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGATCACCTTCNTCGG
JMFF023E12- GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
JMFF035K22- GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
JMFF020B08- GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
JMFF050O13- GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
rJMFF035K22+ GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
rJMFF034O21+ GCGCACNTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
rJMFF035L10+ TCATCGG
rJMFF017D02+ GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
rJMFF023E12+ GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
rJMFF020B08+ GCGCACCTGCTCTGCTTTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACNTTCATCGG
                      ____________________________________________________________
consensus GCGCACCTGCTCTGC-TTCTCCACCGCTTGGGGCGCCGCTCTGTGGGTCACCTTCATCGG
 
. : . : . : . : . : . :
JMFF034A16- CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
JMFF023E12- CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
JMFF035K22- CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
JMFF020B08- CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
JMFF050O13- CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF035K22+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF034O21+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF050O13+ TCATGTTCAAGAATCTGCCGAGGCATCAGTTT-GGAATCTGCAGAGCAAGAT
rJMFF035L10+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF034P09+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTNTGGGAATCTGCAGAGCAAGAT
rJMFF017D02+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF023E12+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
rJMFF020B08+ CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
                      ____________________________________________________________
consensus CGGCATTATCATGTTCAAGAATCTGCCGAGGCATCAGTTTGGGAATCTGCAGAGCAAGAT
 
. : . : . : . : . : . :
JMFF034A16- GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
JMFF023E12- GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
JMFF035K22- GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
JMFF020B08- GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
JMFF050O13- GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF035K22+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF034O21+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF050O13+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF035L10+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMSF050A14+ TCAGTGGCGGCCTTTGG
JMFN043L12- TTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF034P09+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF017D02+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF023E12+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
rJMFF020B08+ GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
                      ____________________________________________________________
consensus GTTCCCGGCGTACTTTACTTTGGTCGGAGTGTGCTGCGCGGTCTCAGTGGCGGCCTTTGG
 
. : . : . : . : . : . :
JMFF034A16- GTACATGCACCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
JMFF023E12- GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
JMFF035K22- GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
JMFF020B08- GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
JMFF050O13- GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF035K22+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF034O21+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF050O13+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF035L10+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMSF050A14+ GTNCATGCATCCATGGAAGACGT-CCNCTAGTGNTGAAAAGTATCAGNTNGTNTTCATTC
JMFN043L12- GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF034P09+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF017D02+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF023E12+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF034A16+ CATGCACCCATGGAAGACGTCCCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
rJMFF020B08+ GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
                      ____________________________________________________________
consensus GTACATGCATCCATGGAAGACGT-CCACTAGTGCTGAAAAGTATCAGATTGTCTTCATTC
 
. : . : . : . : . : . :
JMFF034A16- TGGGTGCCTTTGCTTT
JMFF023E12- TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCA
JMFF035K22- TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
JMFF020B08- TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
JMFF050O13- TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF035K22+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF034O21+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF050O13+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF035L10+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMSF050A14+ TGGGNGCCTTTGCTNNCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
JMFN043L12- TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF034P09+ TGGGTGCNTTTGCTTTCAACCTCAGCAATNTTTTCGNGTTTACTCCCATGACTATCCAGA
rJMFF017D02+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF023E12+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF034A16+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
rJMFF020B08+ TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
                      ____________________________________________________________
consensus TGGGTGCCTTTGCTTTCAACCTCAGCAATCTTTTCGTGTTTACTCCCATGACTATCCAGA
 
. : . : . : . : . : . :
JMFF035K22- TGATGAA
JMFF020B08- TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
JMFF050O13- TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF035K22+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF034O21+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF050O13+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF035L10+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMSF050A14+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGNTGGGTGGA
JMFN043L12- TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF034P09+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF017D02+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF023E12+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF034A16+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
rJMFF020B08+ TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
                      ____________________________________________________________
consensus TGATGAAGCAAAGGCATAAAATTGAGAAAGAGTCAAATATTGGAGATGAAGTTGGGTGGA
 
. : . : . : . : . : . :
JMFF020B08- CCA
JMFF050O13- CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGC
rJMFF035K22+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF034O21+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF050O13+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF035L10+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMSF050A14+ CCAAGAATCAGGAAGTTNCCAAGGTTAATCCAAAGCTNGCTGCCATGAACAAGAA
JMFN043L12- CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF034P09+ CCAAGAATCAGGAAGTTGCCAAGGTNAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF017D02+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF023E12+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF034A16+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
rJMFF020B08+ CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
                      ____________________________________________________________
consensus CCAAGAATCAGGAAGTTGCCAAGGTTAATCCAAAGCTTGCTGCCATGAACAAGAAATTCG
 
. : . : . : . : . : . :
rJMFF035K22+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF034O21+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF050O13+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF035L10+ GAATGGTTACATGGACTCTGTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
JMFN043L12- GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF034P09+ GAATGGTT-CATGGNCTCTCTTNTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF017D02+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF023E12+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF034A16+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
rJMFF020B08+ GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
                      ____________________________________________________________
consensus GAATGGTT-CATGGACTCTCTTCTCTTGCGAATATCGTGTCTTTTGGTTGCCTTGCCATG
 
. : . : . : . : . : . :
rJMFF035K22+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF034O21+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF050O13+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF035L10+ CACTCNTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
JMFN043L12- CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF034P09+ CACTCNNGGTATTTAG
rJMFF017D02+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF023E12+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF034A16+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
rJMFF020B08+ CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
                      ____________________________________________________________
consensus CACTCCTGGTATTTAGCTGGAAAAATTAATTTTTAGATTGAATTGCGGAATATGACCGCC
 
. : . : . : . : . : . :
rJMFF035K22+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF034O21+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF050O13+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF035L10+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATNTGTGCCAAAAA
JMFN043L12- CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF017D02+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF023E12+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF034A16+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
rJMFF020B08+ CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
                      ____________________________________________________________
consensus CTCAGATGTTGTGGGCCTTATAACTATGTATTAAAATCCAGAGATAATGTGTGCCAAAAA
 
. : . : . : . : . : . :
rJMFF035K22+ AATAAAAATATC
rJMFF034O21+ AATAAA
rJMFF050O13+ AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCC
rJMFF035L10+ AATAAAAATAT
JMFN043L12- AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCC
rJMFF017D02+ AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCCAGA
rJMFF023E12+ AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCCAGATAGTTGACATGTAATTTA
rJMFF034A16+ AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCCAGATAGTTGACATGTAATTTA
rJMFF020B08+ AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCCAGATAGTTGACATGTAATTTA
                      ____________________________________________________________
consensus AATAAAAATATCCTGATAATAATACGTACGTTTCGTGCCAGATAGTTGACATGTAATTTA
 
. : . : . : . : . : . :
rJMFF023E12+ TGATGCTTAATCTGCATACAT
rJMFF034A16+ TGATGCTTAATCTGCA
rJMFF020B08+ TGATGCTTAATCTGCATACATGTTGTTTTGAATGAAATGTTGTCTTCATCAGGAAAAGGA
                      ____________________________________________________________
consensus TGATGCTTAATCTGCATACATGTTGTTTTGAATGAAATGTTGTCTTCATCAGGAAAAGGA