Previous Contig 009137:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O24Sequence508002112 (5)gb:AB025631_15165711e-08Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.693009137 (5)
JMFF025E11Sequence306002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se783009137 (5)gb:AE016959_10231772e-39Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFF025O18Sequence290002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se709009137 (5)gb:AE016959_10231775e-50Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFF047A21Sequence458002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se398009137 (5)
JMFF049H12Sequence618002112 (5)gb:AB025631_15165712e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.187009137 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025O18+ GCTCGAACAGT
                      ____________________________________________________________
consensus GCTCGAACAGT
 
. : . : . : . : . : . :
rJMFF025O18+ TGATCCAACAGCTTATGGAAAATGATCCCAACCGTTATGGCACTCCTCCGGCTGCCAAAT
rJMFF025E11+ TCCGGCTGCCAAAT
                      ____________________________________________________________
consensus TGATCCAACAGCTTATGGAAAATGATCCCAACCGTTATGGCACTCCTCCGGCTGCCAAAT
 
. : . : . : . : . : . :
rJMFF025O18+ CTGCTGTTGAAGGGCTTCCGGATATCAAGATCACCCAGGAGATGCTAGCTTCAGACTCCT
rJMFF025E11+ CTGCTGTTGAAGGGCTTCCGGATATCACGATCACCCAGGAGATGCTAGCTTCAGACTCCT
                      ____________________________________________________________
consensus CTGCTGTTGAAGGGCTTCCGGATATCACGATCACCCAGGAGATGCTAGCTTCAGACTCCT
 
. : . : . : . : . : . :
rJMFF025O18+ CTCAATGTGCTGTTTGCAAAGATAGTTTCGAGCTTGATGAGGAGGCGAAGCAAATGCCTT
rJMFF025E11+ CTCAATGTGCTGTTTGCAAAGATAGTTTCGAGCTTGATGAGGAGGCGAAGCAAATGCCTT
                      ____________________________________________________________
consensus CTCAATGTGCTGTTTGCAAAGATAGTTTCGAGCTTGATGAGGAGGCGAAGCAAATGCCTT
 
. : . : . : . : . : . :
rJMFF025O18+ GCAAACATATATACCACAAGGATTGCATTATGCCCTGGCTCGAGTTGCATAACTCATGTC
rJMFF025E11+ GCAAACATATATACCACAAGGATTGCATTATGCCCTGGCTCGAGTTGCATAACTCATGTC
                      ____________________________________________________________
consensus GCAAACATATATACCACAAGGATTGCATTATGCCCTGGCTCGAGTTGCATAACTCATGTC
 
. : . : . : . : . : . :
rJMFF025O18+ CAGTCTGTCGATACGAGTTGCCTACTGATGATCCTGATTATGAGAATAGGAGAAACTCAC
rJMFF025E11+ CAGTCTGTCGATACGAGTTGCCTACTGATGATCCTGATTATGAGAATAGGAGAAACTCAC
                      ____________________________________________________________
consensus CAGTCTGTCGATACGAGTTGCCTACTGATGATCCTGATTATGAGAATAGGAGAAACTCAC
 
. : . : . : . : . : . :
rJMFF025O18+ AGCAGCCGACTAGGAACAACAATAACAGTTTCGGTTTGGGTATTGGGGGTTTGGGAGGTG
rJMFF025E11+ AGCAGCCGACTAGGAACAACAATAACAGTTTCGGTTTGGGTATTGGGGGTTTGGGAGGTG
                      ____________________________________________________________
consensus AGCAGCCGACTAGGAACAACAATAACAGTTTCGGTTTGGGTATTGGGGGTTTGGGAGGTG
 
. : . : . : . : . : . :
rJMFF025O18+ GAGGAAATCAGGAGAATCCTCAGACACCTAGGACAGTGGAAAGAAGGTTTAGGGTTTCAT
rJMFF025E11+ GAGGAAATCAGGAGAATCCTCAGGCACCTAGGACAGTGGAAAGAAGGTTTAGGGTTTCAT
rJMFF019O24+ TAGGACAGTGGAAAGAAGGTTTAGGGTTTCAT
                      ____________________________________________________________
consensus GAGGAAATCAGGAGAATCCTCAGGCACCTAGGACAGTGGAAAGAAGGTTTAGGGTTTCAT
 
. : . : . : . : . : . :
rJMFF025O18+ TGCCATGGCTGTTTGGAGGTTTTGGATCCCCTGCAGAGACCAGCAACAGTGGAGGAGGCA
rJMFF025E11+ TGCCATGGCTGTTTGGAGGTTTTGGATCCCCTGCAGAGACCAGCAACAGTGGAGGAGGCA
rJMFF019O24+ --CCATGGCTGTTTGGAGGTTTTGGATCCCCTGCAGAGACCAGCAACAGTGGAGGAGGCA
                      ____________________________________________________________
consensus TGCCATGGCTGTTTGGAGGTTTTGGATCCCCTGCAGAGACCAGCAACAGTGGAGGAGGCA
 
. : . : . : . : . : . :
rJMFF025O18+ CTGGCAATAATAATGGAGGCGGCATGGGCAACAACAATGGAGGCAATGACAACAACAGAG
rJMFF025E11+ CTGGCAATAATAATGGAGGCGGCATGGGCAACAACAATGGAGGCAATGACAACAACAGAG
rJMFF047A21+ TGGCAATAATAATGGAGGCGGCATGGGCAACAACAATGGAGGCAATGACAACAACAGAG
rJMFF019O24+ CTGGCAATAATAATGGAGGCGGCATGGGCAACAACAATGGAGGCAATGACAACAACAGAG
                      ____________________________________________________________
consensus CTGGCAATAATAATGGAGGCGGCATGGGCAACAACAATGGAGGCAATGACAACAACAGAG
 
. : . : . : . : . : . :
rJMFF025O18+ ATGATACTGGTCACGGCCCAAATTCAGGTTCCTGAAGTCAAG---------GGGGGAGAT
rJMFF025E11+ ATGATACTGGTCACGGCCCAAATTCAGGTTCCTAAAGTCAAGGTGATTGAAGGGGGAGAT
rJMFF047A21+ ATGATACTGGTCACGGCCCAAATTCAGGTTCCTAAAGTCAAGGTGATTGAAGGGGGAGAT
rJMFF019O24+ GTGATACTGGTCACGGCCCAAATTCAGGTTCCTGAAGTCAAGGTGATTGAAGGGGGAGAT
                      ____________________________________________________________
consensus ATGATACTGGTCACGGCCCAAATTCAGGTTCCTGAAGTCAAGGTGATTGAAGGGGGAGAT
 
. : . : . : . : . : . :
rJMFF025O18+ AAAGCAGGGTGTTCAACTATGTATGAAGTTAGAGAAAAAGGAAATATTATACTGTGAGTA
rJMFF025E11+ AAAGCAGGGTGTTCAACTATGTATGAAGTTAGAGAAAAAGGAAATATTATACTGTGAGTA
rJMFF047A21+ AAAGCAGGGTGTTCAACTATGTATGAAGTTAGAGAAAAAGGAAATATTATACTGTGAGTA
rJMFF049H12+ GAGTA
rJMFF019O24+ AAAGCAGGGTGTTCAACTATGTATGAAGTTAGAGAAAAAGGAAATATTATACTGTGAGTA
                      ____________________________________________________________
consensus AAAGCAGGGTGTTCAACTATGTATGAAGTTAGAGAAAAAGGAAATATTATACTGTGAGTA
 
. : . : . : . : . : . :
rJMFF025O18+ GTGATAGATGTGTTTCTAGTGCTTGATGACTAAAATGTT
rJMFF025E11+ GTGATAGATGTGTTTCTAGTGCTTGATGACTAAAATGTTTGTTTCAAAATTTTTTTCCCA
rJMFF047A21+ GTGATAGATGTGTTTCTAGTGCTTGATGACTAAAATGTTTGTTTCAAAATTTTTTTCCCA
rJMFF049H12+ GTGATAGATGTGTTTTTAGTGCTTGATGACTAAAATGTTTGTTTCAAAATTTTTTTCCCA
rJMFF019O24+ GTGATAGATGTGTTTCTAGTGCTTGATGACTAAAATGTTTGTTTCAAAATTTTTTTCCCA
                      ____________________________________________________________
consensus GTGATAGATGTGTTTCTAGTGCTTGATGACTAAAATGTTTGTTTCAAAATTTTTTTCCCA
 
. : . : . : . : . : . :
rJMFF025E11+ TGCTTTTTTATGCTTCTCCTGCACATTTTTCAGAATATGGATGGATATATGTCCTGCTTC
rJMFF047A21+ TGCTTTTTTATGCTTCTCCTGCACATTTTTCAGAATATGGATGGATATATGTCCTGCTTC
rJMFF049H12+ TGCTTTTTTATGCTTTTCCTGCCCATTTTTCAGAATATGGAGGGATATATGTCCTGCTTC
rJMFF019O24+ TGCTTTTTTATGCTTCTCCTGCACATTTTTCAGAATATGGATGGATATATGTCCTGCTTC
                      ____________________________________________________________
consensus TGCTTTTTTATGCTTCTCCTGCACATTTTTCAGAATATGGATGGATATATGTCCTGCTTC
 
. : . : . : . : . : . :
rJMFF025E11+ CTTCCATATATTATCTGGAACTTGGAATCACTGAAAGC
rJMFF047A21+ CTTCCATATATTATCTGGAACTTGGAATCACTGAAAGCACCACAGATTCCTTCCTGCCAA
rJMFF049H12+ CTTCCATATATTATTTGGAACTTGGAATCCCTGAAAGCCCCCCAGATTCCTTCCTGC
rJMFF019O24+ CTTCCATATATTATCTGGAACTTGGAATCACTGAAAGCACCACAGATTCCTTCCTGCCAT
                      ____________________________________________________________
consensus CTTCCATATATTATCTGGAACTTGGAATCACTGAAAGCACCACAGATTCCTTCCTGCCAT
 
. : . : . : . : . : . :
rJMFF047A21+ AAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
rJMFF019O24+ ATTTTCTCATGACATTTTTTTCATTTTCTTGTTTTTTGTTTGCTCAATGACTAGTCTGCT
                      ____________________________________________________________
consensus ATTTTCTCATGACATTTTTTTGGTTTTTTTGTTTTTTGTTTGCTCAATGACTAGTCTGCT
 
. : . : . : . : . : . :
rJMFF019O24+ CATGACTCATGAACGGTATGGCACTTTTTGGATTATCTCAAGTGAAACTTAAAATCCCAA
                      ____________________________________________________________
consensus CATGACTCATGAACGGTATGGCACTTTTTGGATTATCTCAAGTGAAACTTAAAATCCCAA
 
. : . : . : . : . : . :
rJMFF019O24+ CTATATTTTGGATTTTGAGTCAATTTGATATTTGGATGTTTTGATTGAATGTAAGTTTAG
                      ____________________________________________________________
consensus CTATATTTTGGATTTTGAGTCAATTTGATATTTGGATGTTTTGATTGAATGTAAGTTTAG
 
. : . : . : . : . : . :
rJMFF019O24+ TTTGAATATTGGGTGATAAAATTTCACCCATGCCTGATTTCAAATCCAAAATTATTTTTA
                      ____________________________________________________________
consensus TTTGAATATTGGGTGATAAAATTTCACCCATGCCTGATTTCAAATCCAAAATTATTTTTA