Previous Contig 009132:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018M08Sequence510009132 (6)pir|B96497|B964978e-17unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis711009132 (6)pir|B96497|B964974e-14unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis
JMFF019N15Sequence591009132 (6)pir|B96497|B964974e-17unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis748009132 (6)pir|B96497|B964977e-16unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis
JMFF030C24Sequence526009132 (6)pir|B96497|B964972e-08unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis665009132 (6)pir|B96497|B964973e-14unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_892534 Arabidopsis

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030C24- GATTTCTTGTAAACAA
JMFF019N15- GATTTCTTGTAAACAA
                      ____________________________________________________________
consensus GATTTCTTGTAAACAA
 
. : . : . : . : . : . :
JMFF030C24- CGCCGAAAAGATCACAAGATATCCGTCCCGGCATCGTCTTCTTCACTTCTTCTCCCTCAC
JMFF018M08- AC
JMFF019N15- CGCCGAAAAGATCACAAGATATCCGTCCCGGCATCGTCTTCTTCACTTCTTCTCCCTCAC
                      ____________________________________________________________
consensus CGCCGAAAAGATCACAAGATATCCGTCCCGGCATCGTCTTCTTCACTTCTTCTCCCTCAC
 
. : . : . : . : . : . :
JMFF030C24- TCTGAATCGGCTTTTTGACAAACCCCTCTTTCTCACCTCAACTTCCGACAAAATAATGGC
JMFF018M08- TCTGAATCGGCTTTTTGACAAACCCCTCTTTCTCACCTCAACTTCCGACAAAATAATGGC
JMFF019N15- TCTGAATCGGCTTTTTGACAAACCCCTCTTTCTCACCTCAACTTCCGACAAAATAATGGC
                      ____________________________________________________________
consensus TCTGAATCGGCTTTTTGACAAACCCCTCTTTCTCACCTCAACTTCCGACAAAATAATGGC
 
. : . : . : . : . : . :
JMFF030C24- GATGGCTCTATCCAACTCACTGGTTCTATCCAAATCCAAGCCACTGCATTTATCCTCTGG
JMFF018M08- GATGGCTCTATCCAACTCACTGGTTCTATCCAAATCCAAGCCACTGCATTTATCCTCTGG
JMFF019N15- GATGGCTCTATCCAACTCACTGGTTCTATCCAAATCCAAGCCACTGCATTTATCCTCTGG
rJMFF019N15+ AATCCAAGCCACTGCATTTATCCTCTGG
                      ____________________________________________________________
consensus GATGGCTCTATCCAACTCACTGGTTCTATCCAAATCCAAGCCACTGCATTTATCCTCTGG
 
. : . : . : . : . : . :
JMFF030C24- CTTTTGTCTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
JMFF018M08- CTTTTGTCTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
JMFF019N15- CTTTTGTCTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
rJMFF030C24+ TAG
rJMFF018M08+ CTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
rJMFF019N15+ CTTTTGTCTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
                      ____________________________________________________________
consensus CTTTTGTCTGAAGTCAGTTGACCAAAGTGTGTGTCCCACCACATTGTCTTTTAATCCTAG
 
. : . : . : . : . : . :
JMFF030C24- GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
JMFF018M08- GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
JMFF019N15- GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
rJMFF030C24+ GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
rJMFF018M08+ GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
rJMFF019N15+ GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
                      ____________________________________________________________
consensus GCGTGCCAGAAACTCGTCTGTATCGGGAAGTTCATTTGTTGTTCAAGCAAAATATAGTGA
 
. : . : . : . : . : . :
JMFF030C24- AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
JMFF018M08- AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
JMFF019N15- AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
rJMFF030C24+ AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
rJMFF018M08+ AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
rJMFF019N15+ AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
                      ____________________________________________________________
consensus AAGTGATGGTGGGAACTCAACCGCATTTGTTGGTGGCTTCATTTTGGGAGGATTAATTGT
 
. : . : . : . : . : . :
JMFF030C24- CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
JMFF018M08- CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
JMFF019N15- CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
rJMFF030C24+ CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
rJMFF018M08+ CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
rJMFF019N15+ CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
                      ____________________________________________________________
consensus CGGTACACTTGGTTGTGTCTTCGCACCGCAGATCAGTTATGCATTAGCCGGAGCTGATAA
 
. : . : . : . : . : . :
JMFF030C24- GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
JMFF018M08- GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
JMFF019N15- GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
rJMFF030C24+ GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
rJMFF018M08+ GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
rJMFF019N15+ GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
                      ____________________________________________________________
consensus GATTGATAAGAAAGACCTAATGAAGAAATTGCCAAAGTTCATATATGATGAAGAAAAAGT
 
. : . : . : . : . : . :
JMFF030C24- GCTTGAAAGACAACGCAAGAAACTGGCAGA
JMFF018M08- GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
JMFF019N15- GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
rJMFF030C24+ GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
rJMFF018M08+ GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
rJMFF019N15+ GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
                      ____________________________________________________________
consensus GCTTGAAAGACAACGCAAGAAACTGGCAGAGAAGATTGAACAGCTTAACACTGCTATAGA
 
. : . : . : . : . : . :
JMFF018M08- CGACATTTCTTCCCAGATGAAGCACGGC
JMFF019N15- CGACATTTCTTCCCAGATGAAGCACGGCGACAGCC
rJMFF030C24+ CGACATTTCTTCCCAGATGAAGCACGGCGACAGCCAGGATGAACCAGTAGTGAACTCTGA
rJMFF018M08+ CGACATTTCTTCCCAGATGAAGCACGGCGACAGCCAGGATGAACCAGTAGTGAACTCTGA
rJMFF019N15+ CGACATTTCTTCCCAGATGAAGCACGGCGACAGCCAGGATGAACCAGTAGTGAACTCTGA
                      ____________________________________________________________
consensus CGACATTTCTTCCCAGATGAAGCACGGCGACAGCCAGGATGAACCAGTAGTGAACTCTGA
 
. : . : . : . : . : . :
rJMFF030C24+ AGTCGGAGCTGAAGTTGGTTTATAAGAACGCTTTTAGTGGTTTTTACACATTACAGAAGA
rJMFF018M08+ AGTCGGAGCTGAAGTTGGTTTATAAGAACGCTTTTAGTGGTTTTTACACATTACAGAAGA
rJMFF019N15+ AGTCGGAGCTGAAGTTGGTTTATAAGAACGCTTTTAGTGGTTTTTACACATTACAGAAGA
                      ____________________________________________________________
consensus AGTCGGAGCTGAAGTTGGTTTATAAGAACGCTTTTAGTGGTTTTTACACATTACAGAAGA
 
. : . : . : . : . : . :
rJMFF030C24+ CATCAACTTCGTTCTTAGCCTAGAAGTTCTTGAGGGGTGATGAAATTGATCCAACTTTTC
rJMFF018M08+ CATCAACTTCGTTCTTAGCCTAGAAGTTCTTGAGGGGTGATGAAATTGATCCAACTTTTC
rJMFF019N15+ CATCAACTTCGTTCTTAGCCTAGAAGTTCTTGAGGGGTGATGAAATTGATCCAACTTTTC
                      ____________________________________________________________
consensus CATCAACTTCGTTCTTAGCCTAGAAGTTCTTGAGGGGTGATGAAATTGATCCAACTTTTC
 
. : . : . : . : . : . :
rJMFF030C24+ ACTAGTGTCAATGTGTCATTGGTCCTTACTATCACATACTTTCTAAATTCAGGAATAAAA
rJMFF018M08+ ACTAGTGTCAATGTGTCATTGGTCCTTACTATCACATACTTTCTAAATTCAGGAATAAAA
rJMFF019N15+ ACTAGTGTCAATGTGTCATTGGTCCTTACTATCACATACTTTCTAAATTCAGGAATAAAA
                      ____________________________________________________________
consensus ACTAGTGTCAATGTGTCATTGGTCCTTACTATCACATACTTTCTAAATTCAGGAATAAAA
 
. : . : . : . : . : . :
rJMFF030C24+ TGTAAATTTCATCCCCTTCAAATTTTTCTGCTTTATGACTACACTGGTTGCTGCTTTGAA
rJMFF018M08+ TGTAAATTTCATCCCCTTCAAATTTTTCTGCTTTATGACTACACTGGTTGCTGCTTTGAA
rJMFF019N15+ TGTAAATTTCATCCCCTTCAAATTTTTCTGCTTTATGACTACACTGGTTGCTGCTTTGAA
                      ____________________________________________________________
consensus TGTAAATTTCATCCCCTTCAAATTTTTCTGCTTTATGACTACACTGGTTGCTGCTTTGAA
 
. : . : . : . : . : . :
rJMFF030C24+ CTCTTGAGCACTTGTAATGCTGCTATATGTTGTACTTTCGTTTGGTTCACAAAGAAAT
rJMFF018M08+ CTCTTGAGCACTTGTAATGCTGCTATATGTTGTACTTTCGTTTGGTTCACAAAGAAAT
rJMFF019N15+ CTCTTGAGCACTTGTAATGCTGCTATATGTTGTACTTTCGTTTGGTTCACAAAGAAATTT
                      ____________________________________________________________
consensus CTCTTGAGCACTTGTAATGCTGCTATATGTTGTACTTTCGTTTGGTTCACAAAGAAATTT