Previous Contig 009130:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019N01Sequence567009130 (4)gb:AB020742_15145675e-36Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY072313_156733009130 (4)gb:AB020742_15145672e-71Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY072313_156
JMFF031B10Sequence632009130 (4)gb:AB020742_15145674e-40Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY072313_156755009130 (4)gb:AB020742_15145671e-73Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21H1.>gb:AY072313_156

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019N01- GAATTCTTCTTCCCC
JMFF031B10- GAATTCTTCTTCCCC
                      ____________________________________________________________
consensus GAATTCTTCTTCCCC
 
. : . : . : . : . : . :
JMFF019N01- CCACCATCTTCTCTCTCCTCCCTATATCTCTCTGCATTTGAAAGCGCCATTTATCCACGA
JMFF031B10- CCACCATCTTCTCTCTCCTCCCTATATCTCTCTGCATTTGAAAGCGCCATTTATCCACGA
                      ____________________________________________________________
consensus CCACCATCTTCTCTCTCCTCCCTATATCTCTCTGCATTTGAAAGCGCCATTTATCCACGA
 
. : . : . : . : . : . :
JMFF019N01- TTCTTTAACAATTATATTCGGAGCCTTTTGTTTTTGTTTTTTGCATCAAAGCTCTATGTT
JMFF031B10- TTCTTTAACAATTATATTCGGAGCCTTTTGTTTTTGTTTTTTGCATCAAAGCTCTATGTT
                      ____________________________________________________________
consensus TTCTTTAACAATTATATTCGGAGCCTTTTGTTTTTGTTTTTTGCATCAAAGCTCTATGTT
 
. : . : . : . : . : . :
JMFF019N01- TAGCTCCCTAAATTGGTTCAATCTTTGATTCTTTTTGCGAGAGAAACCATGAGGAGACGA
JMFF031B10- TAGCTCCCTAAATTGGTTCAATCTTTGATTCTTTTTGCGAGAGAAACCATGAGGAGACGA
                      ____________________________________________________________
consensus TAGCTCCCTAAATTGGTTCAATCTTTGATTCTTTTTGCGAGAGAAACCATGAGGAGACGA
 
. : . : . : . : . : . :
JMFF019N01- GTAGAAGGAAGGGAAGACGGGGAAGAGGCGGAGATTGATCGCCTCCCCATTGACCTGTTG
JMFF031B10- GTAGAAGGAAGGGAAGACGGGGAAGAGGCGGAGATTGATCGCCTCCCCATTGACCTGTTG
                      ____________________________________________________________
consensus GTAGAAGGAAGGGAAGACGGGGAAGAGGCGGAGATTGATCGCCTCCCCATTGACCTGTTG
 
. : . : . : . : . : . :
JMFF019N01- GCTCATATATTAACTCTTCTCACCTGTTTCAAAGATTTGGCTCAGGCGAGCAGTGTGAGC
JMFF031B10- GCTCATATATTAACTCTTCTCACCTGTTTCAAAGATTTGGCTCAGGCGAGCAGTGTGAGC
rJMFF031B10+ TGTTTCAAAGATTTGGCTCAGGCGAGCAGTGTGAGC
rJMFF019N01+ CGAGCAGTGTGAGC
                      ____________________________________________________________
consensus GCTCATATATTAACTCTTCTCACCTGTTTCAAAGATTTGGCTCAGGCGAGCAGTGTGAGC
 
. : . : . : . : . : . :
JMFF019N01- CAGAAATGGAGGCAGGGAGCTAAAGAATCGTTGGCGAGGAAAGAAAGACTGAGCTTTTCC
JMFF031B10- CAGAAATGGAGGCAGGGAGCTAAAGAATCGTTGGCGAGGAAAGAAAGACTGAGCTTTTCC
rJMFF031B10+ CAGAAATGGAGGCAGGGAGCTAAAGAATCGTTGGCGAGGAAAGAAAGACTGAGCTTTTCC
rJMFF019N01+ CAGAAATGGAGGCAGGGAGCTAAAGAATCGTTGGCGAGGAAAGAAAGACTGAGCTTTTCC
                      ____________________________________________________________
consensus CAGAAATGGAGGCAGGGAGCTAAAGAATCGTTGGCGAGGAAAGAAAGACTGAGCTTTTCC
 
. : . : . : . : . : . :
JMFF019N01- GGGTGGAAAGTGGATGATGATTCCGCCACTCGCCTTGTTCTCCATGCTTACAGTCTTAAA
JMFF031B10- GGGTGGAAAGTGGATGATGATTCCGCCACTCGCCTTGTTCTCCATGCTTACAGTCTTAAA
rJMFF031B10+ GGGTGGAAAGTGGATGATGATTCCGCCACTCGCCTTGTTCTCCATGCTTACAGTCTTAAA
rJMFF019N01+ GGGTGGAAAGTGGATGATGATTCCGCCACTCGCCTTGTTCTCCATGCTTACAGTCTTAAA
                      ____________________________________________________________
consensus GGGTGGAAAGTGGATGATGATTCCGCCACTCGCCTTGTTCTCCATGCTTACAGTCTTAAA
 
. : . : . : . : . : . :
JMFF019N01- GAGCTTGATATTTCAAGGAGCTGTTGGGGTTGCCAGATAACAGATCATGGGCTGTATCAA
JMFF031B10- GAGCTTGATATTTCAAGGAGCTGTTGGGGTTGCCAGATAACAGATCATGGGCTGTATCAA
rJMFF031B10+ GAGCTTGATATTTCAAGGAGCTGTTGGGGTTGCCAGATAACAGATCATGGGCTGTATCAA
rJMFF019N01+ GAGCTTGATATTTCAAGGAGCTGTTGGGGTTGCCAGATAACAGATCATGGGCTGTATCAA
                      ____________________________________________________________
consensus GAGCTTGATATTTCAAGGAGCTGTTGGGGTTGCCAGATAACAGATCATGGGCTGTATCAA
 
. : . : . : . : . : . :
JMFF019N01- TTGTCTATGGCGAAATGTATTAGCAATC-TTTCGTCGGTGTCTCTGTGGGGATCGACAGG
JMFF031B10- TTGTCTATGGCGAAATGTATTAGCAATCTTTTCGTCGGTGTCTCTGTGGGGATCGACAGG
rJMFF031B10+ TTGTCTATGGCGAAATGTATTAGCAATC-TTTCGTCGGTGTCTCTGTGGGGATCGACAGG
rJMFF019N01+ TTGTCTATGGCGAAATGTATTAGCAATC-TTTCGTCGGTGTCTCTGTGGGGATCGACAGG
                      ____________________________________________________________
consensus TTGTCTATGGCGAAATGTATTAGCAATC-TTTCGTCGGTGTCTCTGTGGGGATCGACAGG
 
. : . : . : . : . : . :
JMFF019N01- GATCACAGACGCA
JMFF031B10- GATCACAGACGCAGGTGTTGTTCAACTGATCTCGGGAGCTCGCTCTCTACAACATCTGAA
rJMFF031B10+ GATCACAGACGCAGGTGTTGTTCAACTGATCTCGGGAGCTCGCTCTCTACAACATCTGAA
rJMFF019N01+ GATCACAGACGCAGGTGTTGTTCAACTGATCTCGGGAGCTCGCTCTCTACAACATCTGAA
                      ____________________________________________________________
consensus GATCACAGACGCAGGTGTTGTTCAACTGATCTCGGGAGCTCGCTCTCTACAACATCTGAA
 
. : . : . : . : . : . :
JMFF031B10- TATTGGCGCTACATTTA
rJMFF031B10+ TATTGGCGCTACATTTATAACAGACACATCCTTGTTCGCCATTGCAGACAGCTGCCCGCA
rJMFF019N01+ TATTGGCGCTACATTTATAACAGACACATCCTTGTTCGCCATTGCAGACAGCTGCCCGCA
                      ____________________________________________________________
consensus TATTGGCGCTACATTTATAACAGACACATCCTTGTTCGCCATTGCAGACAGCTGCCCGCA
 
. : . : . : . : . : . :
rJMFF031B10+ CTTAAAGAATATTGGTCTATGGGGTTGTCGCCATGTAACTGAGAGCGGACTCATAGCTCT
rJMFF019N01+ CTTAAAGAATATTGGTCTATGGGGTTGTCGCCATGTAACTGAGAGCGGACTCATAGCTCT
                      ____________________________________________________________
consensus CTTAAAGAATATTGGTCTATGGGGTTGTCGCCATGTAACTGAGAGCGGACTCATAGCTCT
 
. : . : . : . : . : . :
rJMFF031B10+ TGTAAATAAATGTCGCAAGCTTGAATCGATTAATGTTCGGGGGATGAGGGTACCTGTGGA
rJMFF019N01+ TGTAAATAAATGTCGCAAGCTTGAATCGATTAATGTTCGGGGGATGAGGGTACCTGTGGA
                      ____________________________________________________________
consensus TGTAAATAAATGTCGCAAGCTTGAATCGATTAATGTTCGGGGGATGAGGGTACCTGTGGA
 
. : . : . : . : . : . :
rJMFF031B10+ TTGCTTCATTGGTTTGCTTACCATAAGCCCAGCTCTTCAGATAGAACCCAAAGGGTTGCT
rJMFF019N01+ TTGCTTCATTGGTTTGCTTACCATAAGCCCAGCTCTTCAGATAGAACCCAAAGGGTTGCT
                      ____________________________________________________________
consensus TTGCTTCATTGGTTTGCTTACCATAAGCCCAGCTCTTCAGATAGAACCCAAAGGGTTGCT
 
. : . : . : . : . : . :
rJMFF031B10+ GCCAAGCATTGACAGGGTCTCAATGTGGCCTGTCTTTTAAGCTGCCTATCAGCAGTGATC
rJMFF019N01+ GCCAAGCATTGACAGGGTCTCAATGTGGCCTGTCTTTTAAGCTGCCTATCAGCAGTGATC
                      ____________________________________________________________
consensus GCCAAGCATTGACAGGGTCTCAATGTGGCCTGTCTTTTAAGCTGCCTATCAGCAGTGATC
 
. : . : . : . : . : . :
rJMFF031B10+ ACAGCTTTTACCCATTCTGTGTAAATAAGATTGATTGATGCTTCAAGTATGATATTTTCA
rJMFF019N01+ ACAGCTTTTACCCATTCTGTGTAAATAAGATTGATTGATGCTTCAAGTATGATATTTTCA
                      ____________________________________________________________
consensus ACAGCTTTTACCCATTCTGTGTAAATAAGATTGATTGATGCTTCAAGTATGATATTTTCA
 
. : . : . : . : . : . :
rJMFF031B10+ ATTAATTTGTACAGATTGTTTCTCCATTTCTTTGTTCTATTGGTATCCCCCAATTCCAAT
rJMFF019N01+ ATTAATTTGTACAGATTGTTTCTCCATTTCTTTGTTCTATTGGTATCCCCCAATTCCAAT
                      ____________________________________________________________
consensus ATTAATTTGTACAGATTGTTTCTCCATTTCTTTGTTCTATTGGTATCCCCCAATTCCAAT