Previous Contig 009127:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N01Sequence547009127 (8)gb:AJ620676_18123185e-34Oryza sativa (japonica cultivar-group) mRNA for zinc finger protein, clone Z52.607009127 (8)gb:AY525368_16116092e-41Oryza sativa (japonica cultivar-group) zinc finger protein LSD1 mRNA, complete c
JMFF019L18Sequence590009127 (8)gb:AJ620676_18123183e-43Oryza sativa (japonica cultivar-group) mRNA for zinc finger protein, clone Z52.753009127 (8)gb:AY525368_16116093e-50Oryza sativa (japonica cultivar-group) zinc finger protein LSD1 mRNA, complete c
JMFF027L15Sequence585009127 (8)gb:AJ620676_18123184e-40Oryza sativa (japonica cultivar-group) mRNA for zinc finger protein, clone Z52.286009127 (8)
JMFF028L11Sequence598009127 (8)gb:AJ620676_18123181e-42Oryza sativa (japonica cultivar-group) mRNA for zinc finger protein, clone Z52.415009127 (8)gb:AY581829_16160690.006Cynodon dactylon putative zinc finger protein mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF027L15- AGTATCTTTGAACATTTTCAAGAGTTTTTGGAGAAATT
JMFF028L11- AGTATCTTTGAACATTTTCAAGAGTTTTTGGAGAAATT
JMFF001N01- ATTTTCAAGAGTTTTTGGAGAAATT
JMFF019L18- ATTTTCAAGAGTTTTTGGAGAAATT
                      ____________________________________________________________
consensus AGTATCTTTGAACATTTTCAAGAGTTTTTGGAGAAATT
 
. : . : . : . : . : . :
JMFF027L15- TTTCCTTCATCCTCCACACTCTAAAGGAGTGTGTCTCACTCTCTCCTCCTAAATGCTCAA
JMFF028L11- TTTCCTTCATCCTCCACACTCTAAAGGAGTGTGTCTCACTCTCTCCTCCTAAATGCTCAA
JMFF001N01- TTTCCTTCATCCTCCACACTCTAAAGGAGTGTGTCTCACTCTCTCCTCCTAAATGCTCAA
JMFF019L18- TTTCCTTCATCCTCCACACTCTAAAGGAGTGTGTCTCACTCTCTCCTCCTAAATGCTCAA
                      ____________________________________________________________
consensus TTTCCTTCATCCTCCACACTCTAAAGGAGTGTGTCTCACTCTCTCCTCCTAAATGCTCAA
 
. : . : . : . : . : . :
JMFF027L15- CTAAATTCCTATATTCTTCAATGCATCAAGCAATACCCATGGCAAAGTGAAGATGATAGG
JMFF028L11- CTAAATTCCTATATTCTTCAATGCATCAAGCAATACCCATGGCAAAGTGAAGATGATAGG
JMFF001N01- CTAAATTCCTATATTCTTCAATGCATCAAGCAATACCCATGGCAAAGTGAAGATGATAGG
JMFF019L18- CTAAATTCCTATATTCTTCAATGCATCAAGCAATACCCATGGCAAAGTGAAGATGATAGG
                      ____________________________________________________________
consensus CTAAATTCCTATATTCTTCAATGCATCAAGCAATACCCATGGCAAAGTGAAGATGATAGG
 
. : . : . : . : . : . :
JMFF027L15- TACTATGTTTCATGTCTCTGAAGTAGCTTGCACTTAGGAGTTAGAAAAGGGCTACCATTT
JMFF028L11- TACTATGTTTCATGTCTCTGAAGTAGCTTGCACTTAGGAGTTAGAAAAGGGCTACCATTT
JMFF001N01- TACTATGTTTCATGTCTCTGAAGTAGCTTGCACTTAGGAGTTAGAAAAGGGCTACCATTT
JMFF019L18- TACTATGTTTCATGTCTCTGAAGTAGCTTGCACTTAGGAGTTAGAAAAGGGCTACCATTT
                      ____________________________________________________________
consensus TACTATGTTTCATGTCTCTGAAGTAGCTTGCACTTAGGAGTTAGAAAAGGGCTACCATTT
 
. : . : . : . : . : . :
JMFF027L15- TTCAGATCCACCATCATGCCTGTTCCTCTTGCTCCATATCCAACAGCTCCAGCTCCATCA
JMFF028L11- TTCAGATCCACCATCATGCCTGTTCCTCTTGCTCCATATCCAACAGCTCCAGCTCCATCA
JMFF001N01- TTCAGATCCACCATCATGCCTGTTCCTCTTGCTCCATATCCAACAGCTCCAGCTCCATCA
JMFF019L18- TTCAGATCCACCATCATGCCTGTTCCTCTTGCTCCATATCCAACAGCTCCAGCTCCATCA
                      ____________________________________________________________
consensus TTCAGATCCACCATCATGCCTGTTCCTCTTGCTCCATATCCAACAGCTCCAGCTCCATCA
 
. : . : . : . : . : . :
JMFF027L15- CCACTTATGTCTCCTGCACCTAATGGTGCACAAAGCCAGCTTGTGTGTTCTGGGTGTCGA
JMFF028L11- CCACTTATGTCTCCTGCACCTAATGGTGCACAAAGCCAGCTTGTGTGTTCTGGGTGTCGA
JMFF001N01- CCACTTATGTCTCCTGCACCTAATGGTGCACAAAGCCAGCTTGTGTGTTCTAGGTGTCGA
JMFF019L18- CCACTTATGTCTCCTGCACCTAATGGTGCACAAAGCCAGCTTGTGTGTTCTGGGTGTCGA
rJMFF019L18+ GCACAAAGCCAGCTTGTGTGTTCTGGGTGTCGA
                      ____________________________________________________________
consensus CCACTTATGTCTCCTGCACCTAATGGTGCACAAAGCCAGCTTGTGTGTTCTGGGTGTCGA
 
. : . : . : . : . : . :
JMFF027L15- AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
JMFF028L11- AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
JMFF001N01- AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
JMFF019L18- AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
rJMFF001N01+ TAATGTATCCAGTNGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
rJMFF019L18+ AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
                      ____________________________________________________________
consensus AACCTTTTAATGTATCCAGTTGGAGCAACCTCAGTATGCTGTGCAGTATGCAGTGCAGTA
 
. : . : . : . : . : . :
JMFF027L15- ACTGCAGTACCTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
JMFF028L11- ACTGCAGTACCTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
JMFF001N01- ACTGCAGTACCTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
JMFF019L18- ACTGCAGTACCTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
rJMFF001N01+ NCTGCAGTACCTCCNCCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
rJMFF019L18+ ACTGCAGTACNTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
                      ____________________________________________________________
consensus ACTGCAGTACCTCCACCAGGCACTGAAATGGCTCAGCTAATCTGTGGTGGGTGCCACACA
 
. : . : . : . : . : . :
JMFF027L15- TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
JMFF028L11- TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
JMFF001N01- TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
JMFF019L18- TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
rJMFF001N01+ TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACNCCATCAAT
rJMFF019L18+ TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
                      ____________________________________________________________
consensus TTGCTAATGTATATTCGTGGAGCAACAAGCGTTCAGTGCTCATGTTGCCACACCATCAAT
 
. : . : . : . : . : . :
JMFF027L15- TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
JMFF028L11- TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
JMFF001N01- TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGC
JMFF019L18- TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
rJMFF001N01+ TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
rJMFF019L18+ TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
                      ____________________________________________________________
consensus TTAGCTTTGGAAGCAAATCAGGTGGCACATGTGAACTGTGGCAACTGTAGAATGCTATTG
 
. : . : . : . : . : . :
JMFF027L15- ATGTACC
JMFF028L11- ATGTACCAATATGGGGCAAG
JMFF019L18- ATGTACCAATATGGGGCAAGA
rJMFF001N01+ ATGTACCAATATGGGGCAAGATCTGTCAAATGTGCAGTNTGCAACTTTTTGACACCAGTA
rJMFF028L11+ GGGGCAAGATCTGTCAAATGTGCAGTCTGCAACTTTTTGACACCAGTA
rJMFF019L18+ ATGTACCAATATGGGGCAAGATCTGTCAAATGTGCAGTCTGCAACTTTTTGACACCAGTA
                      ____________________________________________________________
consensus ATGTACCAATATGGGGCAAGATCTGTCAAATGTGCAGTCTGCAACTTTTTGACACCAGTA
 
. : . : . : . : . : . :
rJMFF001N01+ GGGGTTTCACCGAACATGAACGAACAGAAGTTGAAGAGCTAGCTAGNTAGNTGAAGAGTG
rJMFF028L11+ GGGGTTTCACCGAACATGNACGAACAGAAGTTGAAGAGCTAGCTAGNTAGNTGAAGAGTG
rJMFF027L15+ GAAGAGNG
rJMFF019L18+ GGGGTTTCACCGAACATGAACGAACAGAAGTTGAAGAGCTAGCTAGCTAGCTGAAGAGTG
                      ____________________________________________________________
consensus GGGGTTTCACCGAACATGAACGAACAGAAGTTGAAGAGCTAGCTAGCTAGCTGAAGAGTG
 
. : . : . : . : . : . :
rJMFF001N01+ AAAGAGTGAAGGTAGAAGGTTTCCATGCATGTTATGAAAGGATATATATGTGGCCTGGAC
rJMFF028L11+ AAAGAGTGAAGGTAGAAGGTTTCCATGCATGTTATGAAAGGATATATATGTGGCCTGGAC
rJMFF027L15+ AAAGAGTGAAGGTAGAAGGTTTCCATGCATGTTATGAAAGGATATATANGTGGCCTGGAC
rJMFF019L18+ AAAGAGTGAAGGTAGAAGGTTTCCATGCATGTTATGAAAGGATATATATGTGGCCTGGAC
                      ____________________________________________________________
consensus AAAGAGTGAAGGTAGAAGGTTTCCATGCATGTTATGAAAGGATATATATGTGGCCTGGAC
 
. : . : . : . : . : . :
rJMFF001N01+ AGGCAGATCAGAAGAGGAATAATAATGTGGTTGTTACATGTATAGAGCTTAGNTAATTTT
rJMFF028L11+ AGGCAGATCAGAAGAGGAATAATAATGTGGTTGTTACATGTATAGAGCTTAGCTAATTTT
rJMFF027L15+ AGTCAGATCAGAAGAGGAATAATAATGTGGTTGTTACANGTATAGAGCTTAGCTAATTTT
rJMFF019L18+ AGGCAGATCAGAAGAGGAATAATAATGTGGTTGTTACATGTATAGAGCTTAGCTAATTTT
                      ____________________________________________________________
consensus AGGCAGATCAGAAGAGGAATAATAATGTGGTTGTTACATGTATAGAGCTTAGCTAATTTT
 
. : . : . : . : . : . :
rJMFF001N01+ CCCATGCGTGAATGTAATATGAATAAGCAGTTTTTTCTGGGTTGGAGCTGCGACTAATTA
rJMFF028L11+ CCCATGCGTGAATGTAATATGAATAAGCAGTTTTTTNTGGGTTGGAGCTGCGACTAATTA
rJMFF027L15+ NCCATGCGTGAATGTAATATGAATAAGCAGTTTTTTNTGGGTTGGAGCTGCGACTAATTA
rJMFF019L18+ CCCATGCGTGAATGTAATATGAATAAGCAGTTTTTTCTGGGTTGGAGCTGCGACTAATTA
                      ____________________________________________________________
consensus CCCATGCGTGAATGTAATATGAATAAGCAGTTTTTTCTGGGTTGGAGCTGCGACTAATTA
 
. : . : . : . : . : . :
rJMFF001N01+ ATTAATGGGTGTTTTCTGGTTGGAGAGTAACATGAAATGCTCTCATCTACTTCCTCTACA
rJMFF028L11+ ATTAATGGGTGTTTTCTGGTTGGAGAGTAACATGAAATGCTCTCATCTACTTCCTCTACA
rJMFF027L15+ ANTAATGGGAGTTTTCTGGTTGGAGAGTAACATGAAATGCTCTCATCTNCTTCCTCTACA
rJMFF019L18+ ATTAATGGGTGTTTTCTGGTTGGAGAGTAACATGAAATGCTCTCATCTACTTCCTCTACA
                      ____________________________________________________________
consensus ATTAATGGGTGTTTTCTGGTTGGAGAGTAACATGAAATGCTCTCATCTACTTCCTCTACA
 
. : . : . : . : . : . :
rJMFF001N01+ AGG
rJMFF028L11+ AGGTATAGTTGCAGTACATTTATTGTGTTTACACTTGATGTAATGAATAGTGACAT
rJMFF027L15+ AGGNATANTTGCAGTACATTTATTG
rJMFF019L18+ AGGTATAGTTGCAGTACATTTATTGTGTTTACACTTGATGTAATGAATAGTGACATTGAA
                      ____________________________________________________________
consensus AGGTATAGTTGCAGTACATTTATTGTGTTTACACTTGATGTAATGAATAGTGACATTGAA
 
. : . : . : . : . : . :
rJMFF019L18+ GACACCAGGGTGGCTAAGTGGGTAAAACATGACTCTTGTACATGAATTAATGTCACGAGT
                      ____________________________________________________________
consensus GACACCAGGGTGGCTAAGTGGGTAAAACATGACTCTTGTACATGAATTAATGTCACGAGT