Previous Contig 009121:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011F04Sequence581009121 (6)gb:BT020391_16427865e-22Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops
JMFF019J22Sequence525009121 (6)gb:AC135563_17425725e-13Oryza sativa chromosome 3 BAC OSJNBb0015I02 genomic sequence, complete sequence.735009121 (6)gb:BT020391_16427867e-64Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops
JMSF040L05Sequence658009121 (6)gb:BT020391_16427863e-20Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops880009121 (6)gb:BT020391_16427868e-66Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops
JMSF044M15Sequence734007632 (2)pir|H96573|H965731e-45protein F12M16.29 [imported] - Arabidopsis thaliana>gb:AE005173_893242 Arabidops721009121 (6)gb:BT020391_16427867e-64Arabidopsis thaliana At4g00840 mRNA, complete cds.>gb:BT020511_1642905 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019J22- ACCGTTTTACGATTTATCGTCCCCCAACAACCGCCGT
                      ____________________________________________________________
consensus ACCGTTTTACGATTTATCGTCCCCCAACAACCGCCGT
 
. : . : . : . : . : . :
JMFF019J22- CGGTGAATCGGCTCCCAAACCGAAACTCCGGCGAACCTAACCAAAAAAATAAAGTGTACA
JMSF040L05- ATCGGCTCCCAAACCGAAACTCCGGCGAACCTAACCAAAAAAATAAAGTGTACA
                      ____________________________________________________________
consensus CGGTGAATCGGCTCCCAAACCGAAACTCCGGCGAACCTAACCAAAAAAATAAAGTGTACA
 
. : . : . : . : . : . :
JMFF019J22- TAGAGCCTGAGCTCAATATCATCGTATATTCTCCACTTCCCGGTAAGGGAATCTGGCGTC
JMSF040L05- TAGAGCCTGAGCTCAATATCATCGTATATTCTCCACTTCCCGGTAAGGGAATCTGGCGTC
JMFF011F04- ATTCTCCACTTCCCGGTAAGGGAATCTGGCGTC
                      ____________________________________________________________
consensus TAGAGCCTGAGCTCAATATCATCGTATATTCTCCACTTCCCGGTAAGGGAATCTGGCGTC
 
. : . : . : . : . : . :
JMFF019J22- CGATATCTGGAAACGCTTATTCCCTGCTCGATCGAGGAGGCCATCGGGGTTGGTTTTGCC
JMSF040L05- CGATATCTGGAAACGCTTATTCCCTGCTCGATCGAGGAGGCCATCGGGGTTGGTTTTGCC
JMFF011F04- CGATATCTGGAAACGCTTATTCCCTGCTCGATCGAGGAGGCCATCGGGGTTGGTTTTGCC
                      ____________________________________________________________
consensus CGATATCTGGAAACGCTTATTCCCTGCTCGATCGAGGAGGCCATCGGGGTTGGTTTTGCC
 
. : . : . : . : . : . :
JMFF019J22- TCGATACGGACCGGTCCGGCTATCTACTGCCTCCGCTCCAATGGATATGAACCCCTTCCG
JMSF040L05- TCGATACGGACCGGTCCGGCTATCTACTGCCTCCGCTCCAATGGATATGAACCCCTTCCG
JMFF011F04- TCGATACGGACCGGTCCGGCTATCTACTGCCTCCGCTCCAATGGATATGAACCCCTTCCG
                      ____________________________________________________________
consensus TCGATACGGACCGGTCCGGCTATCTACTGCCTCCGCTCCAATGGATATGAACCCCTTCCG
 
. : . : . : . : . : . :
JMFF019J22- GCTATGTTCCGGCCTCAGATTCCTAGGCTATTTCATGATCGTCATCGTTTTAGCAATTGT
JMSF040L05- GCTATGTTCCGGCCTCAGATTCCTAGGCTATTTCATGATCGTCATCGTTTTAGCAATTGT
JMFF011F04- GCTATGTTCCGGCCTCAGATTCCTAGGCTATTTCATGATCGTCATCGTTTTAGCAATTGT
                      ____________________________________________________________
consensus GCTATGTTCCGGCCTCAGATTCCTAGGCTATTTCATGATCGTCATCGTTTTAGCAATTGT
 
. : . : . : . : . : . :
JMFF019J22- AGCTGTCTCCTATTACGCCGTTGTTATTGTTACCTGGGGCCCTCACCTCCTCGACGGCGG
JMSF040L05- AGCTGTCTCCTATTACGCCGTTGTTATTGTTACCTGGGGCCCTCACCTCCTCGACGGCGG
JMFF011F04- AGCTGTCTCCTATTACGCCGTTGTTATTGTTACCTGGGGCCCTCACCTCCTCGACGGCGG
                      ____________________________________________________________
consensus AGCTGTCTCCTATTACGCCGTTGTTATTGTTACCTGGGGCCCTCACCTCCTCGACGGCGG
 
. : . : . : . : . : . :
JMFF019J22- CTCCCACTCCTTCTTCTCCTTCACCATTCTCACTATCTTTCATATCCTCCTTGTATTGCT
JMSF040L05- CTCCCACTCCTTCTTCTCCTTCACCATTCTCACTATCTTTCATATCCTCCTTGTATTGCT
JMFF011F04- CTCCCACTCCTTCTTCTCCTTCACCATTCTCACTATCTTTCATATCCTCCTTGTATTGCT
                      ____________________________________________________________
consensus CTCCCACTCCTTCTTCTCCTTCACCATTCTCACTATCTTTCATATCCTCCTTGTATTGCT
 
. : . : . : . : . : . :
JMFF019J22- ATCATGGAGCTACATTAGGGTAATCCTTCAGGACCCTGGTTCTGTTCCAGAAAACTGGAA
JMSF040L05- ATCATGGAGCTACATTAGGGTAATCCTTCAGGACCCTGGTTCTGTTCCAGAAAACTGGAA
JMFF011F04- ATCATGGAGCTACATTAGGGTAATCCTTCAGGACCCTGGTTCTGTTCCAGAAAACTGGAA
rJMSF040L05+ GAGCTACATTAGGGTAATCCTTCAGGACCCTGGTTCTGTTCCAGAAAACTGGAA
                      ____________________________________________________________
consensus ATCATGGAGCTACATTAGGGTAATCCTTCAGGACCCTGGTTCTGTTCCAGAAAACTGGAA
 
. : . : . : . : . : . :
JMFF019J22- AGTAGTAC
JMSF040L05- AGTAGTACCAGAGCAGAGTGTAGAGGAGGGCTGTTCAGTGTCGTTGCCTGCTTATGCAGG
JMFF011F04- AGTAGTACCAGAGCAGAGTGTAGAGGAGGGCTGTTCAGTGTCGTTGCCTGCTTATGCAGG
rJMSF040L05+ AGTAGTACCAGAGCAGAGTGTAGAGGAGGGCTGTTCAGTGTCGTTGCCTGCTTATGCAGG
                      ____________________________________________________________
consensus AGTAGTACCAGAGCAGAGTGTAGAGGAGGGCTGTTCAGTGTCGTTGCCTGCTTATGCAGG
 
. : . : . : . : . : . :
JMSF040L05- ACCCGAGAATTTGGCCTCTGCATCATCATCATCTTCAGGCACAGGAGAAAGAAGACAGGC
JMFF011F04- ACCCGAGAATTTGGCCTCTGCATCATCATCATCTTCAGGCACAGGAGAAAGAAGACAGGC
rJMSF040L05+ ACCCGAGAATTTGGCCTCTGCATCATCATCATCTTCAGGCACAGGAGAAAGAAGACAGGC
rJMSF044M15+ GAAGACAGGC
rJMFF019J22+ AGGAGAAAGAAGACAGGC
                      ____________________________________________________________
consensus ACCCGAGAATTTGGCCTCTGCATCATCATCATCTTCAGGCACAGGAGAAAGAAGACAGGC
 
. : . : . : . : . : . :
JMSF040L05- TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
JMFF011F04- TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
rJMSF040L05+ TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
rJMSF044M15+ TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
rJMFF019J22+ TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
                      ____________________________________________________________
consensus TGTAGGATTTTGCAGTCATTGTCAAAATGGCAAACCACCTCGCTGCCATCACTGTTCTGT
 
. : . : . : . : . : . :
JMSF040L05- T
JMFF011F04- TTGCCAGA
rJMSF040L05+ TTGCCAGAGATGTGTTCTCAAGATGGATCACCACTGCTTATGGGTTGTAAACTGCATTGG
rJMSF044M15+ TTGCCAGAGATGTGTTCTCAAGATGGATCACCACTGCTTATGGGTTGTAAACTGCATTGG
rJMFF019J22+ TTGCCAGAGATGTGTTCTCAAGATGGATCACCACTGCTTATGGGTTGTAAACTGCATTGG
                      ____________________________________________________________
consensus TTGCCAGAGATGTGTTCTCAAGATGGATCACCACTGCTTATGGGTTGTAAACTGCATTGG
 
. : . : . : . : . : . :
rJMSF040L05+ GGCTTGGAACTACAAGTTTTTTCTTCTCTTTGTGATTTACACATTTTTGGAGACAACACT
rJMSF044M15+ GGCTTGGAACTACAAGTTTTTTCTTCTCTTTGTGATTTACACATTTTTGGAGACAACACT
rJMFF019J22+ GGCTTGGAACTACAAGTTTTTTCTTCTCTTTGTGATTTACACATTTTTGGAGACAACACT
                      ____________________________________________________________
consensus GGCTTGGAACTACAAGTTTTTTCTTCTCTTTGTGATTTACACATTTTTGGAGACAACACT
 
. : . : . : . : . : . :
rJMSF040L05+ GGATACTTTGGTGCTGCTGCCAAGTTTTATAGAATTCTTCAAAAAATCCAAGCATCGCTC
rJMSF044M15+ GGATACTTTGGTGCTGCTGCCAAGTTTTATAGAATTCTTCAAAAAATCCAAGCATCACTC
rJMFF019J22+ GGATACTTTGGTGCTGCTGCCAAGTTTTATAGAATTCTTCAAAAAATCCAAGCATCACTC
                      ____________________________________________________________
consensus GGATACTTTGGTGCTGCTGCCAAGTTTTATAGAATTCTTCAAAAAATCCAAGCATCACTC
 
. : . : . : . : . : . :
rJMSF040L05+ TTTCTCGCCAGGCAATCTTGCTATCATTTTTCTGGCCTTTGTTTTAAATCTAGCGTTTGC
rJMSF044M15+ TTTCTCGCCAGGCAATCTTGCTATCATTTTTCTGGCCTTTGTTTTAAATCTAGCGTTTGC
rJMFF019J22+ TTTCTCGCCAGGCAATCTTGCTATCATTTTTCTGGCCTTTGTTTTAAATCTAGCGTTTGC
                      ____________________________________________________________
consensus TTTCTCGCCAGGCAATCTTGCTATCATTTTTCTGGCCTTTGTTTTAAATCTAGCGTTTGC
 
. : . : . : . : . : . :
rJMSF040L05+ ACTCAGCCTTCTTTGTTTCGTAGTTATGCATGCATCTCTTGTCTCCAGCAACACCACTTC
rJMSF044M15+ ACTCAGCCTTCTTTGTTTCGTAGTTATGCATGCATCTCTTGTCTCCAGCAACACCACTTC
rJMFF019J22+ ACTCAGCCTTCTTTGTTTCGTAGTTATGCATGCATCTCTTGTCTCCAGCAACACCACTTC
                      ____________________________________________________________
consensus ACTCAGCCTTCTTTGTTTCGTAGTTATGCATGCATCTCTTGTCTCCAGCAACACCACTTC
 
. : . : . : . : . : . :
rJMSF040L05+ AGTGGAGGTTTATGAAAAGAAAAGAAATTTGCGATGGAAGTATGACCTGGGGTGGAAACA
rJMSF044M15+ AGTGGAGGTTTATGAAAAGAAAAGAAATTTGCGATGGAAGTATGACCTGGGGTGGAAACA
rJMFF019J22+ AGTGGAGGTTTATGAAAAGAAAAGAAATTTGCGATGGAAGTATGACCTGGGGTGGAAACA
                      ____________________________________________________________
consensus AGTGGAGGTTTATGAAAAGAAAAGAAATTTGCGATGGAAGTATGACCTGGGGTGGAAACA
 
. : . : . : . : . : . :
rJMSF040L05+ GAATTTTGTGCAGGTTTTTGGGAGTAGCAAGGCATTGTGGTTTTTGCCATTATTCTCAAA
rJMSF044M15+ GAATTTTGTGCAGGTTTTTGGGAGTAGCAAGGCATTGTGGTTTTTGCCATTATTCTCAAA
rJMFF019J22+ GAATTTTGTGCAGGTTTTTGGGAGTAGCAAGGCATTGTGGTTTTTGCCATTATTCTCAAA
                      ____________________________________________________________
consensus GAATTTTGTGCAGGTTTTTGGGAGTAGCAAGGCATTGTGGTTTTTGCCATTATTCTCAAA
 
. : . : . : . : . : . :
rJMSF040L05+ GAAAGATTTGGAGAGCATCCCTGCACTGAATGGGTTGGAGTTCCCGGCACGCCCGGATGT
rJMSF044M15+ GAAAGATTTGGAGAGCATCCCTGCACTGAATGGGTTGGAGTTCCCGGCACGCCCGGATGT
rJMFF019J22+ GAAAGATTTGGAGAGCATCCCTGCACTGAATGGGTTGGAGTTCCCGGCACGCCCGGATGT
                      ____________________________________________________________
consensus GAAAGATTTGGAGAGCATCCCTGCACTGAATGGGTTGGAGTTCCCGGCACGCCCGGATGT
 
. : . : . : . : . : . :
rJMSF040L05+ TGAAGAGTGAGAATCTCAGATCCAGCTAAGGTAACATGCATGCAGCAGAAGCTTGTTGTA
rJMSF044M15+ TGAAGAGTGAGAATCTCAGATCCAGCTAAGGTAACATGCATGCAGCAGAAGCTTGTTGTA
rJMFF019J22+ TGAAGAGTGAGAATCTCAGATCCAGCTAAGGTAACATGCATGCAGCAGAAGCTTGTTGTA
                      ____________________________________________________________
consensus TGAAGAGTGAGAATCTCAGATCCAGCTAAGGTAACATGCATGCAGCAGAAGCTTGTTGTA
 
. : . : . : . : . : . :
rJMSF040L05+ TAATTGTGTTTCTTGATTTCGTCAATGACTTGTTTGTTGTTTGTATTTACACTTT-CA-T
rJMSF044M15+ TAATTGTGTTTCTTGATTTCGTCAATGACTTGTTTGTTGTTTGTATTTACACTTTGCACT
rJMFF019J22+ TAATTGTGTTTCTTGATTTCGTCAATGACTTGTTTGTTGTTTGTATTTACACTTT-CA-T
                      ____________________________________________________________
consensus TAATTGTGTTTCTTGATTTCGTCAATGACTTGTTTGTTGTTTGTATTTACACTTT-CA-T
 
. : . : . : . : . : . :
rJMSF040L05+ GTGTGTATCTTGCAAGTTTTGAATATGTATATTCTGTAAT
rJMSF044M15+ GTGTGTATCTTGCAAG-TTTGAATATGTATATTCTGTAAT
rJMFF019J22+ GTGTGTATCTTGCAAG-TTTGAATATGTATATTCTGTAATCTGTAGTGTGTACTAGATAT
                      ____________________________________________________________
consensus GTGTGTATCTTGCAAG-TTTGAATATGTATATTCTGTAATCTGTAGTGTGTACTAGATAT