Previous Contig 009120:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019J12Sequence563000987 (3)pir|T48498|T484982e-72hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi791009120 (3)pir|T48498|T484985e-27hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi
JMFF020B23Sequence627000987 (3)pir|T48498|T484981e-83hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi736009120 (3)pir|T48498|T484984e-24hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi
JMSF036C11Sequence728000987 (3)pir|T48498|T484989e-97hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi741009120 (3)pir|T48498|T484981e-30hypothetical protein T28J14.210 - Arabidopsis thaliana>gb:ATT28J14_1555608 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF036C11+ TATGTACGCCAT
rJMFF019J12+ ATGTACGCCAT
                      ____________________________________________________________
consensus TATGTACGCCAT
 
. : . : . : . : . : . :
rJMSF036C11+ GCATGCTTCATACTGATGAGCAAGACGACAACCA-TTCAACATCTAGCAGTGCACAGAAT
rJMFF020B23+ TAGCAGTGCACAGAAT
rJMFF019J12+ GCATGCTTCATACTGATGAGCAAGACGACAACCATTTCAACATTTAGCAGTGCACAGAAT
                      ____________________________________________________________
consensus GCATGCTTCATACTGATGAGCAAGACGACAACCATTTCAACATTTAGCAGTGCACAGAAT
 
. : . : . : . : . : . :
rJMSF036C11+ ATTAGAAGGAACCGTGTAGCTTCAGTTTCTTCAGATATTTTTTGTCCTGCCACGTGTAAC
rJMFF020B23+ ATTAGAAGGAACCGTGTAGCTTCAGTTTCTTCAGATATTTTTTGTCNTGCCACGTGTAAC
rJMFF019J12+ ATTAGAAGGAACCGTGTAGCTTCAGTTTCTTCAGATATTTTTTGTCCTGCCACGTGTAAC
                      ____________________________________________________________
consensus ATTAGAAGGAACCGTGTAGCTTCAGTTTCTTCAGATATTTTTTGTCCTGCCACGTGTAAC
 
. : . : . : . : . : . :
rJMSF036C11+ CCCTTTCCTTCTGTTGCTATCCCTTTGTGCACATGCAATGAGGGGCCATGCCCGACTTTT
rJMFF020B23+ CCCTTTCCTTCTGTTGCTATCCCTTTGTGCACATGCAATGAGGGGCCATGCCCGACTTTT
rJMFF019J12+ CCCTTTCCTTCTGTTGCTATCCCTTTGTGCACATGCAATGAGGGGCCATGCCCGACTTTT
                      ____________________________________________________________
consensus CCCTTTCCTTCTGTTGCTATCCCTTTGTGCACATGCAATGAGGGGCCATGCCCGACTTTT
 
. : . : . : . : . : . :
rJMSF036C11+ GAATCCAGAGATAATGAAGTTCAAGAGGGGTCTCACCATCAATCAGAATCGACATCAGAG
rJMFF020B23+ GAATCCAGAGATAATGAAGTTCAAGAGGGGTCTCACCATCAATCAGAATCGACATCAGAG
rJMFF019J12+ GAATCCAGAGATAATGAAGTTCAAGAGGGGTCTCACCATCAATCAGAATCGACATCAGAG
                      ____________________________________________________________
consensus GAATCCAGAGATAATGAAGTTCAAGAGGGGTCTCACCATCAATCAGAATCGACATCAGAG
 
. : . : . : . : . : . :
rJMSF036C11+ GAGCAAGAGAAGATGGGAGGAGTAAGGTTGGAGAAAACTACGTGCTCAAGCATGTTTTGG
rJMFF020B23+ GAGCAAGAGGAGATGGGAGGAGTAAGGTTGGAGAAAACTACGTGCTCAAGCATGTTTTGG
rJMFF019J12+ GAGCAAGAGAAGATGGGAGGAGTAAGGTTGGAGAAAACTACGTGCTCAAGCATGTTTTGG
                      ____________________________________________________________
consensus GAGCAAGAGAAGATGGGAGGAGTAAGGTTGGAGAAAACTACGTGCTCAAGCATGTTTTGG
 
. : . : . : . : . : . :
rJMSF036C11+ GGCAGAAGGAGCTGCAGCAGGGAGAATCAGTGTAATGCTGAAATTAATGCTTGAACCACC
rJMFF020B23+ GGCAGAAGGAGCTGCAGCAGGGAGAATCAGTGTAATGCTGAAATTAATGCTTGAACCACC
rJMFF019J12+ GGCAGAAGGAGCTGCAGCAGGGAGAATCAGTGTAATGCTGAAATTAATGCTTGAACCACC
                      ____________________________________________________________
consensus GGCAGAAGGAGCTGCAGCAGGGAGAATCAGTGTAATGCTGAAATTAATGCTTGAACCACC
 
. : . : . : . : . : . :
rJMSF036C11+ CCCCTTGGTTTGGAAACATATCCATAGAGGGATGGAACTTTGTGAACAGAGCAGTTAACG
rJMFF020B23+ CCCCTTGGTTTGGAAACATATCCATAGAGGGATGGAACTTTGTGAACAGAGCAGTTAACG
rJMFF019J12+ CCCCTTGGTTTGGAAACATATCCATAGAGGGATGGAACTTTGTGAACAGAGCAGTTAACG
                      ____________________________________________________________
consensus CCCCTTGGTTTGGAAACATATCCATAGAGGGATGGAACTTTGTGAACAGAGCAGTTAACG
 
. : . : . : . : . : . :
rJMSF036C11+ ATGAAATCACCATACTTTCGCATGTTGTTCTCTTGGCTTGGCTTGGCTGGTGTTGTGATA
rJMFF020B23+ ATGAAATCACCATACTTTCGCATGTTGTTCTCTTGGCTTGGCTTGGCTGGTGTTGTGATA
rJMFF019J12+ ATGAAATCACCATACTTTCGCATGTTGTTCTCTTGGCTTGGCTTGGCTGGTGTTGTGATA
                      ____________________________________________________________
consensus ATGAAATCACCATACTTTCGCATGTTGTTCTCTTGGCTTGGCTTGGCTGGTGTTGTGATA
 
. : . : . : . : . : . :
rJMSF036C11+ AATTATCCAGGTCAGGAATTGCAATGTCTTGACCCATATTAGATTGCCTAAAGACGCATG
rJMFF020B23+ AATTATCCAGGTCAGGAATTGCAATGTCTTGACCCATATTAGATTGCCTAAAGACGCATG
rJMFF019J12+ AATTATCCAGGTCAGGAATTGCAATGTCTTGACCCATATTAGATTGCCTAAAGACGCATG
                      ____________________________________________________________
consensus AATTATCCAGGTCAGGAATTGCAATGTCTTGACCCATATTAGATTGCCTAAAGACGCATG
 
. : . : . : . : . : . :
rJMSF036C11+ GCCTCTGGGTGGTGGCTTTTAAAGTAATCCAACATTGAGAATACAGTGTGGTTGAAATAT
rJMFF020B23+ GCCTCTGGGTGGTGGCTTTTAAAGTAATCCAACATTGAGAATACAGTGTGGTTGAAATAT
rJMFF019J12+ GCCTCTGGGTGGTGGCTTTTAAAGTAATCCAACATTGAGAATACAGTGTGGTTGAAATAT
                      ____________________________________________________________
consensus GCCTCTGGGTGGTGGCTTTTAAAGTAATCCAACATTGAGAATACAGTGTGGTTGAAATAT
 
. : . : . : . : . : . :
rJMSF036C11+ ACAAGATTGGCATTTGTAGTTGGAGGCCGAGGCCCCGTCTGTAGTAAGTGAGCATTTTGT
rJMFF020B23+ ACAAGATTGGCATTTGTAGTTGGAGGCCGAGGCCCCGTCTGTAGTAAGTGAGCATTTTGT
rJMFF019J12+ ACAAGATTGGCATTTGTAGTTGGAGGCCGAGGCCCCGTCTGTAGTAAGTGAGCATTTTGT
                      ____________________________________________________________
consensus ACAAGATTGGCATTTGTAGTTGGAGGCCGAGGCCCCGTCTGTAGTAAGTGAGCATTTTGT
 
. : . : . : . : . : . :
rJMSF036C11+ ATTGTTTCTAGGAGATTAGTGATGTTTGTAAATGTGAATCCTTAGGGTGGTGGGTGTGTA
rJMFF020B23+ ATTGTTTCTAGGAGATTAGTGATGTTTGTAAATGTGAATCCTTAGGGTGGTGGGTGTGTA
rJMFF019J12+ ATTGTTTCTAGGAGATTAGTGATGTTTGTAAATGTGAATCCTTAGGGTGGTGGGTGTGTA
                      ____________________________________________________________
consensus ATTGTTTCTAGGAGATTAGTGATGTTTGTAAATGTGAATCCTTAGGGTGGTGGGTGTGTA
 
. : . : . : . : . : . :
rJMSF036C11+ AAGCTGCTGA
rJMFF020B23+ AAGCTGCTGATAAACAAGTGAATGTAAGGGAAGGAAATATATTTGCATCAT
rJMFF019J12+ AAGCTGCTGATAAACAAGTGAATGTAAGGGAAGGAAATATATTTGCATCATTNTACAAAA
                      ____________________________________________________________
consensus AAGCTGCTGATAAACAAGTGAATGTAAGGGAAGGAAATATATTTGCATCATTNTACAAAA