Previous Contig 009118:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019I22Sequence543000985 (4)gb:ATAC016795_15435962e-64Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequen713009118 (2)gb:ATAC016795_15435965e-59Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequen
JMSF038C14Sequence667000985 (4)gb:ATAC016795_15435963e-86Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequen804009118 (2)gb:ATAC016795_15435961e-77Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF038C14+ TGGTGGAGCAGATCAGTTCATTGAAGAAGCTGAG
                      ____________________________________________________________
consensus TGGTGGAGCAGATCAGTTCATTGAAGAAGCTGAG
 
. : . : . : . : . : . :
rJMSF038C14+ AGAAGCCTGCATGATGCAATTATGATTGTTAGAAGAGCTGTAAAAAATTCTACTGTTGTT
                      ____________________________________________________________
consensus AGAAGCCTGCATGATGCAATTATGATTGTTAGAAGAGCTGTAAAAAATTCTACTGTTGTT
 
. : . : . : . : . : . :
rJMSF038C14+ GCTGGTGGCGGTGCTATAGATATGGAGATTAGCCGATATTTGAGGCAGCATTCACGCACA
rJMFF019I22+ GCGGTGCTATAGATATGGAGATTAGCCGATATTTGAGGCAGCATTCACGCACA
                      ____________________________________________________________
consensus GCTGGTGGCGGTGCTATAGATATGGAGATTAGCCGATATTTGAGGCAGCATTCACGCACA
 
. : . : . : . : . : . :
rJMSF038C14+ ATAAAGGGGAAGTCTCAGCTCTTTATAAACTCATATGCCAAAGCCCTTGAGATTATTCCA
rJMFF019I22+ ATAAAGGGGAAGTCTCAGCTCTTTATAAACTCATATGCCAAAGCCCTTGAGATTATTCCA
                      ____________________________________________________________
consensus ATAAAGGGGAAGTCTCAGCTCTTTATAAACTCATATGCCAAAGCCCTTGAGATTATTCCA
 
. : . : . : . : . : . :
rJMSF038C14+ CGGCAATTGTGTGATAATGCTGGTTTTGATGCAACTGATGTGCTGAACAAACTCAGACAA
rJMFF019I22+ CGGCAATTGTGTGATAATGCTGGTTTTGATGCAACTGATGTGCTGAACAAACTCAGACAA
                      ____________________________________________________________
consensus CGGCAATTGTGTGATAATGCTGGTTTTGATGCAACTGATGTGCTGAACAAACTCAGACAA
 
. : . : . : . : . : . :
rJMSF038C14+ AAACATGCTCTTCCTTCAGGTGAGGGCGCACCTTATGGGGTGGATATTAATACCGGTGGC
rJMFF019I22+ AAACATGCTCTTCCTTCAGGTGAGGGCGCACCTTATGGGGTGGATATTAATACCGGTGGC
                      ____________________________________________________________
consensus AAACATGCTCTTCCTTCAGGTGAGGGCGCACCTTATGGGGTGGATATTAATACCGGTGGC
 
. : . : . : . : . : . :
rJMSF038C14+ ATATCAAATTCATTTGCTAATTTTGTCTGGGAACCATCAGTTGTGAAGATAAATGCCATT
rJMFF019I22+ ATATCAAATTCATTTGCTAATTTTGTCTGGGAACCATCAGTTGTGAAGATAAATGCCATT
                      ____________________________________________________________
consensus ATATCAAATTCATTTGCTAATTTTGTCTGGGAACCATCAGTTGTGAAGATAAATGCCATT
 
. : . : . : . : . : . :
rJMSF038C14+ AATGCTGCTACTGAAGCATGTTGCCTTATCCTTAGCGTGGATGAAACAGTGAAGAACCCC
rJMFF019I22+ AATGCTGCTACTGAAGCATGTTGCCTTATCCTTAGCGTGGATGAAACAGTGAAGAACCCC
                      ____________________________________________________________
consensus AATGCTGCTACTGAAGCATGTTGCCTTATCCTTAGCGTGGATGAAACAGTGAAGAACCCC
 
. : . : . : . : . : . :
rJMSF038C14+ AAGTCTGAGAGTGCCCAGGGAGCTGCTGCAGGTGGCATGGGCGGAAGAGGCGGATTTGCT
rJMFF019I22+ AAGTCTGAGAGTGCCCAGGGAGCTGCTGCAGGTGGCATGGGCGGAAGAGGCGGATTTGCT
                      ____________________________________________________________
consensus AAGTCTGAGAGTGCCCAGGGAGCTGCTGCAGGTGGCATGGGCGGAAGAGGCGGATTTGCT
 
. : . : . : . : . : . :
rJMSF038C14+ TCTCGGGGTCGAGGACGTGGGATGCGAAGGCGATAGGCTTTTCGCATTATTCGATTGCAT
rJMFF019I22+ TCTCGGGGTCGAGGACGTGGGATGCGAAGGCGATAGGCTTTTCGCATTATTCGATTGCAT
                      ____________________________________________________________
consensus TCTCGGGGTCGAGGACGTGGGATGCGAAGGCGATAGGCTTTTCGCATTATTCGATTGCAT
 
. : . : . : . : . : . :
rJMSF038C14+ TTCTTCTCAATCTCAAGCTCACTATGTTACCTTCTGCAAATGATGCAGAAATCTAATGGT
rJMFF019I22+ TTCTTCTCAATCTCAAGCTCACTATGTTACCTTCTGCAAATGATGCAGAAATCTAATGGT
                      ____________________________________________________________
consensus TTCTTCTCAATCTCAAGCTCACTATGTTACCTTCTGCAAATGATGCAGAAATCTAATGGT
 
. : . : . : . : . : . :
rJMSF038C14+ ATCATTATGCAGTGTGATGTTCCAATTTCAGATGCTCATATGTGTGTGTACTGAGTTTTT
rJMFF019I22+ ATCATTATGCAGTGTGATGTTCCAATTTCAGATGCTCATATGTGTGTGTACTGAGTTTTT
                      ____________________________________________________________
consensus ATCATTATGCAGTGTGATGTTCCAATTTCAGATGCTCATATGTGTGTGTACTGAGTTTTT
 
. : . : . : . : . : . :
rJMSF038C14+ ATGGCATCTGATAAAGCAGTGCAAAAGAGAGAATTTCCTCGTCATCTTCTGATATAAGTA
rJMFF019I22+ ATGGCATCTGATAAAGCAGTGCAAAAGAGAGAATTTCCTCGTCATCTTCTGATATAAGTA
                      ____________________________________________________________
consensus ATGGCATCTGATAAAGCAGTGCAAAAGAGAGAATTTCCTCGTCATCTTCTGATATAAGTA
 
. : . : . : . : . : . :
rJMSF038C14+ GATGCTGTGCGTGTTACTCCTCGCCGTTGTATAACACTTTGAAAGGGAT
rJMFF019I22+ GATGCTGTGCGTGTTACTCCTCGCCGTTGTATAACACTTTGAAAGGGATTGATAATTAAT
                      ____________________________________________________________
consensus GATGCTGTGCGTGTTACTCCTCGCCGTTGTATAACACTTTGAAAGGGATTGATAATTAAT