Previous Contig 009117:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002O05Sequence488009117 (12)pir|T50691|T506915e-77amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF012A02Sequence554009117 (12)gb:STAAP1_17226882e-89Solanum tuberosum mRNA for amino acid transporter (aap1 gene).
JMFF015H13Sequence466009117 (12)pir|T50691|T506915e-75amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF015H14Sequence528009117 (12)pir|T50691|T506912e-82amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF015N15Sequence607009117 (12)pir|T50691|T506915e-92amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF019I20Sequence733009117 (12)pir|T50691|T506911e-98amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF020G16Sequence490009117 (12)pir|T50691|T506912e-81amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF031L02Sequence201009117 (12)gb:STAAP1_17226882e-26Solanum tuberosum mRNA for amino acid transporter (aap1 gene).
JMFF032K22Sequence636009117 (12)pir|T50691|T506917e-88amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF038E21Sequence729009117 (12)pir|T50691|T50691e-100amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF039D15Sequence483009117 (12)pir|T50691|T506911e-75amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMSF039D22Sequence676009117 (12)pir|T50691|T506919e-97amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039D22+ TAC
                      ____________________________________________________________
consensus TAC
 
. : . : . : . : . : . :
rJMSF039D22+ TCANCTGTCCTCATCGAGATACAGGACACATTGAGATCACACCCACCAGAAAACAAGGTA
rJMFF038E21+ CAAGGTA
rJMFF012A02+ CAAGGTA
rJMFF019I20+ CAAGGTA
                      ____________________________________________________________
consensus TCANCTGTCCTCATCGAGATACAGGACACATTGAGATCACACCCACCAGAAAACAAGGTA
 
. : . : . : . : . : . :
rJMSF039D22+ ATGAAGAAAGCATCT-GGGTTGGAGTGACCACAACCACATTGTTCTATGTCCTATGTGGT
rJMFF038E21+ ATGAAGAAAGCATCTGGGGTTGGAGTGACCACAACCACATTGTTCTATGTCCTATGTGGT
rJMFF032K22+ TATGTGGT
rJMFF015H14+ TATGTCCTATGTGGT
rJMFF015N15+ TTCTATGTCCTATGTGGT
rJMFF012A02+ ATGAGGAAAGCATCTGGGGTTGGAGTGACCACAACCACATTGTTCTATGTCCTATGTGGT
rJMFF020G16+ TATGTGGT
rJMFF019I20+ ATGAAGAAAGCATCTGGGGTTGGAGTGACCACAACCACATTGTTCTATGTCCTATGTGGT
                      ____________________________________________________________
consensus ATGAAGAAAGCATCTGGGGTTGGAGTGACCACAACCACATTGTTCTATGTCCTATGTGGT
 
. : . : . : . : . : . :
rJMFF002O05+ CGG
rJMSF039D22+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF038E21+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF032K22+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF015H14+ TGCCTNGGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCNTCACCGGTTTCGG
rJMFF015H13+ CACCGGTTTCGG
rJMFF015N15+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF012A02+ TGCCT-NGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF020G16+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
rJMFF019I20+ TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
                      ____________________________________________________________
consensus TGCCT-TGGCTATGCGGCGTTCGGAAACAATGCTCCCGGAAACTTCCTCACCGGTTTCGG
 
. : . : . : . : . : . :
rJMFF039D15+ TCTACGAGCCNTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF002O05+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMSF039D22+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF038E21+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF032K22+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF015H14+ CTTCTACGAGCCNTTCTGGNTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF015H13+ CTTNTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTNTGCATCGCCATCCATCTCAT
rJMFF015N15+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF012A02+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF020G16+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
rJMFF019I20+ CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
                      ____________________________________________________________
consensus CTTCTACGAGCCCTTCTGGCTGATCGACTTCGCCAACGTCTGCATCGCCATCCATCTCAT
 
. : . : . : . : . : . :
rJMFF039D15+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF002O05+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMSF039D22+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF038E21+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF032K22+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF015H14+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF015H13+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF015N15+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF012A02+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF020G16+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
rJMFF019I20+ CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
                      ____________________________________________________________
consensus CGGCGCTTACCAGGTTTTTTGCCAACCACTATTCAGCTTTGTCGAGTCTCGCTGCAGCCA
 
. : . : . : . : . : . :
rJMFF039D15+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF002O05+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMSF039D22+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF038E21+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF032K22+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF015H14+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF015H13+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF015N15+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF012A02+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF020G16+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
rJMFF019I20+ GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
                      ____________________________________________________________
consensus GAGATGGCCAGACAGCAAATTCATAACCGCGGAATATGAAGTGAATGTCCCATGCTTTGG
 
. : . : . : . : . : . :
rJMFF039D15+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF031L02+ TGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF002O05+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMSF039D22+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF038E21+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF032K22+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF015H14+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF015H13+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF015N15+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF012A02+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF020G16+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
rJMFF019I20+ CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
                      ____________________________________________________________
consensus CACTTGCTCCATCAACTTCTTCAGGCTGGTGTGGAGAACAGGTTATGTCATAGTCACAGC
 
. : . : . : . : . : . :
rJMFF039D15+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF031L02+ CGTGGTNGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF002O05+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMSF039D22+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF038E21+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF032K22+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF015H14+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF015H13+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF015N15+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF012A02+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF020G16+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
rJMFF019I20+ CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
                      ____________________________________________________________
consensus CGTGGTTGCCATGATATTCCCGTTCTTCAACGACTTCTTGGGGCTGATTGGGGCCGCCTC
 
. : . : . : . : . : . :
rJMFF039D15+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF031L02+ GTTNTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF002O05+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMSF039D22+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF038E21+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF032K22+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF015H14+ GTTCTATCCACTCACCCTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF015H13+ GTTCTATCCACTCACCCTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF015N15+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF012A02+ GTTCTATCCACTCACCGTCCACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF020G16+ GTTCTATCCACTCACCGTCCACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
rJMFF019I20+ GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
                      ____________________________________________________________
consensus GTTCTATCCACTCACCGTCTACTTCCCGATTGAGATGCACATCGCCCAGACCAAGATCCC
 
. : . : . : . : . : . :
rJMFF039D15+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF031L02+ CAAGTACTCGTTCAGATGGATATGNNTGAAGATCCTGAGCNGGACTTGCC
rJMFF002O05+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMSF039D22+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF038E21+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF032K22+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF015H14+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF015H13+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF015N15+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF012A02+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF020G16+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
rJMFF019I20+ CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
                      ____________________________________________________________
consensus CAAGTACTCGTTCAGATGGATATGGCTGAAGATCCTGAGCTGGACTTGCCTGGTTGTATC
 
. : . : . : . : . : . :
rJMFF039D15+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTC-AAGACGTACAAAC
rJMFF002O05+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTC-AAGACGTACAAAC
rJMSF039D22+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTC-AAGACGTACAAAC
rJMFF038E21+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGNGTNTGATGTC-AAGACGTACAAAC
rJMFF032K22+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTCTAAGACGTACAAAC
rJMFF015H14+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCT
rJMFF015H13+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTC
rJMFF015N15+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTC-AAGACGTACAAAC
rJMFF012A02+ GCT
rJMFF020G16+ GCT
rJMFF019I20+ GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTTTGATGTC-AAGACGTACAAAC
                      ____________________________________________________________
consensus GCTCGTCGCTGCTGCTGGATCCATTCAAGGGCTCGCGTCTGATGTC-AAGACGTACAAAC
 
. : . : . : . : . : . :
rJMFF039D15+ CTTTC
rJMFF002O05+ CTTTC
rJMSF039D22+ CTTTCAAAGCTCAAT
rJMFF038E21+ CTTTCAAAGCTCAATGAGTAGCCGGAACAAAGTAATGAACTTGNGAAAAATGTAATGTTA
rJMFF032K22+ CTNTCAAAGCTCAATGAGTANCCGGAACAAAGTAATGAACTTGNGAAAAATGTAATGNTA
rJMFF015N15+ CTNTCAAAGCTCAATGAGTANCCGGAACAAAGTAATGAA
rJMFF019I20+ CTTTCAAAGCTCAATGAGTAGCCGGAACAAAGTAATGAACTTGTGAAAAATGTAATGTTA
                      ____________________________________________________________
consensus CTTTCAAAGCTCAATGAGTAGCCGGAACAAAGTAATGAACTTGTGAAAAATGTAATGTTA
 
. : . : . : . : . : . :
rJMFF038E21+ NGAAATAANTTAAGAANTAGTTCATGGTAGTGAACTGCAATGTAGTGATGTTC
rJMFF032K22+ NGAAATAA
rJMFF019I20+ TGAAATAAGTNAAGAACTAGTTCATGGTAGTGAGCTGCAATGTAGTGATGTTCAAAAAAT
                      ____________________________________________________________
consensus TGAAATAAGTTAAGAACTAGTTCATGGTAGTGAGCTGCAATGTAGTGATGTTCAAAAAAT