Previous Contig 009114:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019H18Sequence566009114 (4)pir|H96808|H968084e-29protein F28K19.14 [imported] - Arabidopsis thaliana>gb:AE005173_895315 Arabidops788009114 (4)pir|H96808|H968082e-57protein F28K19.14 [imported] - Arabidopsis thaliana>gb:AE005173_895315 Arabidops
JMFF019N04Sequence608009114 (4)pir|H96808|H968085e-31protein F28K19.14 [imported] - Arabidopsis thaliana>gb:AE005173_895315 Arabidops746009114 (4)pir|H96808|H968089e-48protein F28K19.14 [imported] - Arabidopsis thaliana>gb:AE005173_895315 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019H18- ATTGATTTCTGTCTCTTCGTCGTTCGATCGAACCGA
JMFF019N04- ATTGATTTCTGTCTCTTCGTCGTTCGATCGAACCGA
                      ____________________________________________________________
consensus ATTGATTTCTGTCTCTTCGTCGTTCGATCGAACCGA
 
. : . : . : . : . : . :
JMFF019H18- CTACCTTCACTAATCACTACCGTATTATCCTCACCGATTCCAAGAATACAGGTAGAAAAG
JMFF019N04- CTACCTTCACTAATCACTACCGTATTATCCTCACCGATTCCAAGAATACAGGTAGAAAAG
                      ____________________________________________________________
consensus CTACCTTCACTAATCACTACCGTATTATCCTCACCGATTCCAAGAATACAGGTAGAAAAG
 
. : . : . : . : . : . :
JMFF019H18- ATTAAAGATTTTCAGAAAAAAAATTGAGCTGAAATTCAAGTATTCAACCGCAGAGAAGAG
JMFF019N04- ATTAAAGATTTTCAGAAAAAAAATTGAGCTGAAATTCAAGTATTCAACCGCAGAGAAGAG
                      ____________________________________________________________
consensus ATTAAAGATTTTCAGAAAAAAAATTGAGCTGAAATTCAAGTATTCAACCGCAGAGAAGAG
 
. : . : . : . : . : . :
JMFF019H18- ATTAGGGAAGAAATATGAGCAATCTGAGGGCAATTTGTAGACCTCATGCAGTTTTCTCTT
JMFF019N04- ATTAGGGAAGAAATATGAGCAATCTGAGGGCAATTTGTAGACCTCATGCAGTTTTCTCTT
                      ____________________________________________________________
consensus ATTAGGGAAGAAATATGAGCAATCTGAGGGCAATTTGTAGACCTCATGCAGTTTTCTCTT
 
. : . : . : . : . : . :
JMFF019H18- CAATCACCTGTTGCTGCAGAGGACTGTTGGTCAAATCGACGGTTCGCGTTCCGGTTCGGA
JMFF019N04- CAATCACCTGTTGCTGCAGAGGACTGTTGGTCAAATCGACGGTTCGCGTTCCGGTTCGGA
                      ____________________________________________________________
consensus CAATCACCTGTTGCTGCAGAGGACTGTTGGTCAAATCGACGGTTCGCGTTCCGGTTCGGA
 
. : . : . : . : . : . :
JMFF019H18- TCCCTAGCCCCGGACCTCGATGGAGCACAAAGCCGCCGGCGTTCTCGACGTGGTTCGATT
JMFF019N04- TCCCTAGCCCCGGACCTCGATGGAGCACAAAGCCGCCGGCGTTCTCGACGTGGTTCGATT
                      ____________________________________________________________
consensus TCCCTAGCCCCGGACCTCGATGGAGCACAAAGCCGCCGGCGTTCTCGACGTGGTTCGATT
 
. : . : . : . : . : . :
JMFF019H18- CGTCCAGGAGAATTGAGCCCTGGGATGGAGTGAATAGGCGGCAGAGGAAGAGCATAGCTA
JMFF019N04- CGTCCAGGAGAATTGAGCCCTGGGATGGAGTGAATAGGCGGCAGAGGAAGAGCATAGCTA
                      ____________________________________________________________
consensus CGTCCAGGAGAATTGAGCCCTGGGATGGAGTGAATAGGCGGCAGAGGAAGAGCATAGCTA
 
. : . : . : . : . : . :
JMFF019H18- CTAATTCATACAATTGGAACAACTCCAAATCCCCTTACGAAACCCTCGAGTTGGAAGGAG
JMFF019N04- CTAATTCATACAATTGGAACAACTCCAAATCCCCTTACGAAACCCTCGAGTTGGAAGGAG
                      ____________________________________________________________
consensus CTAATTCATACAATTGGAACAACTCCAAATCCCCTTACGAAACCCTCGAGTTGGAAGGAG
 
. : . : . : . : . : . :
JMFF019H18- ATGCAGATGAAGAGCAAATAAAGGTGGCATACAGACG-TTTGGTGAAGTTCTACCATCCA
JMFF019N04- ATGCAGATGAAGAGCAAATAAAGGTGGCATACAGACGTTTTGGTGAAGTTCTACCATCCA
rJMFF019H18+ ACCATCCA
                      ____________________________________________________________
consensus ATGCAGATGAAGAGCAAATAAAGGTGGCATACAGACGTTTTGGTGAAGTTCTACCATCCA
 
. : . : . : . : . : . :
JMFF019H18- GATGTTTATGATGGCAGTGGGACTCTTGAAGAGGGGGAAACTGCTGAAACA
JMFF019N04- GATGTTTATGATGGCAGTGGGACTCTTGAAGAGGGGGAAACTGCTGAAACACGATTTATT
rJMFF019N04+ GGGAAACTGCTGAAACACGATTTATT
rJMFF019H18+ GATGTTTATGATGGCAGTGGGACTCTTGAAGAGGGGGAAACTGCTGAAACACGATTTATT
                      ____________________________________________________________
consensus GATGTTTATGATGGCAGTGGGACTCTTGAAGAGGGGGAAACTGCTGAAACACGATTTATT
 
. : . : . : . : . : . :
JMFF019N04- AAGATTCAAGCTGCTTATGAGTTGCTGCTAGA
rJMFF019N04+ AAGATTCAAGCTGCTTATGAGTTGCTGCTAGATAAAGAACAACGAAGGCAATATGACAAA
rJMFF019H18+ AAGATTCAAGCTGCTTATGAGTTGCTGCTAGATAAAGAACAACGAAGGCAATATGACAAA
                      ____________________________________________________________
consensus AAGATTCAAGCTGCTTATGAGTTGCTGCTAGATAAAGAACAACGAAGGCAATATGACAAA
 
. : . : . : . : . : . :
rJMFF019N04+ GAAAATCGGGTGAACCNTATGAAGGCATCCCAAGCATGGATGGAATGGCTTATTAAAAAG
rJMFF019H18+ GAAAATCGGGTGAACCCTATGAAGGCATCCCAAGCATGGATGGAATGGCTTATTAAAAAG
                      ____________________________________________________________
consensus GAAAATCGGGTGAACCCTATGAAGGCATCCCAAGCATGGATGGAATGGCTTATTAAAAAG
 
. : . : . : . : . : . :
rJMFF019N04+ CGGAAAGCATTTGACCAACGGGGTGATATGGCTATTGCAGCATGGGCTGAACAGCAGCAG
rJMFF019H18+ CGGAAAGCATTTGACCAACGGGGTGATATGGCTATTGCAGCATGGGCTGAACAGCAGCAG
                      ____________________________________________________________
consensus CGGAAAGCATTTGACCAACGGGGTGATATGGCTATTGCAGCATGGGCTGAACAGCAGCAG
 
. : . : . : . : . : . :
rJMFF019N04+ CGTGAATTGAATCTTAAAGCACGCCGCCTTGCACGATCAAAGATGGATCCTGAAGAGGAG
rJMFF019H18+ CGTGAATTGAATCTTAAAGCACGCCGCCTTGCACGATCAAAGATGGATCCTGAAGAGGAG
                      ____________________________________________________________
consensus CGTGAATTGAATCTTAAAGCACGCCGCCTTGCACGATCAAAGATGGATCCTGAAGAGGAG
 
. : . : . : . : . : . :
rJMFF019N04+ AGGAAAATACTGGAGAAAGAGAGGAAGGCATCATTGGAAAATGTTAACACTACTTTGAGG
rJMFF019H18+ AGGAAAATACTGGAGAAAGAGAGGAAGGCATCATTGGAAAATGTTAACACTACTTTGAGG
                      ____________________________________________________________
consensus AGGAAAATACTGGAGAAAGAGAGGAAGGCATCATTGGAAAATGTTAACACTACTTTGAGG
 
. : . : . : . : . : . :
rJMFF019N04+ CGGCATACACTTGTGTTACGGAAAAGGGATATAATGCGAAGAAAAGCAGAAGAGGAGAAG
rJMFF019H18+ CGGCATACACTTGTGTTACGGAAAAGGGATATAATGCGAAGAAAAGCAGAAGAGGAGAAG
                      ____________________________________________________________
consensus CGGCATACACTTGTGTTACGGAAAAGGGATATAATGCGAAGAAAAGCAGAAGAGGAGAAG
 
. : . : . : . : . : . :
rJMFF019N04+ AAAAGGTTGATTAACCAGCTGCTGGCAGCAGAGGGACTTGAGCTTGAAGAGGAGGATGAT
rJMFF019H18+ AAAAGGTTGATTAACCAGCTGCTGGCAGCAGAGGGACTTGAGCTTGAAGAGGAGGATGAT
                      ____________________________________________________________
consensus AAAAGGTTGATTAACCAGCTGCTGGCAGCAGAGGGACTTGAGCTTGAAGAGGAGGATGAT
 
. : . : . : . : . : . :
rJMFF019N04+ AAAAGCTTGTAGAATATACACCACCCTGTTATAGCCGCTATACTTTAAACGTTGCTTGGG
rJMFF019H18+ AAAAGCTTGTAGAATATACACCACCCTGTTATAGCCGCTATACTTTAAACGTTGCTTGGG
                      ____________________________________________________________
consensus AAAAGCTTGTAGAATATACACCACCCTGTTATAGCCGCTATACTTTAAACGTTGCTTGGG
 
. : . : . : . : . : . :
rJMFF019N04+ GGTATACTTGTCTGTTTATTGTACATGGAAGATGAAAGTTGCATTGTACATTGGAAAACT
rJMFF019H18+ GGTATACTTGTCTGTTTATTGTACATGGAAGATGAAAGTTGCATTGTACATTGGAAAACT
                      ____________________________________________________________
consensus GGTATACTTGTCTGTTTATTGTACATGGAAGATGAAAGTTGCATTGTACATTGGAAAACT
 
. : . : . : . : . : . :
rJMFF019N04+ CTTGAAATGTGCAAAGATGAAAGTCCATGAATTCGGTTCTTTCATCGTTCACTTGTTCCA
rJMFF019H18+ CTTGAAATGTGCAAAGATGAAAGTCCATGAATTCGGTTCTTTCATCGTTCACTTGTTCCA
                      ____________________________________________________________
consensus CTTGAAATGTGCAAAGATGAAAGTCCATGAATTCGGTTCTTTCATCGTTCACTTGTTCCA
 
. : . : . : . : . : . :
rJMFF019N04+ GTTCTTATGGGAAAACTCCTGAAATGTTCCTTGTAATTGAATGTTGATGCATAGGCATCT
rJMFF019H18+ GTTCTTATGGGAAAACTCCTGAAATGTTCCTTGTAATTGAATGTTGATGCATAGGCATCT
                      ____________________________________________________________
consensus GTTCTTATGGGAAAACTCCTGAAATGTTCCTTGTAATTGAATGTTGATGCATAGGCATCT
 
. : . : . : . : . : . :
rJMFF019N04+ ATATTTCACATTCTCCCTTCAACTCCAATTATTTGTAAGGGATTGAGTAGGGAAAGATAT
rJMFF019H18+ ATATTTCACATTCTCCCTTCAACTCCAATTATTTGTAAGGGATTGAGTAGGGAAAGATAT
                      ____________________________________________________________
consensus ATATTTCACATTCTCCCTTCAACTCCAATTATTTGTAAGGGATTGAGTAGGGAAAGATAT