Previous Contig 009100:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B14Sequence597009100 (3)gb:AY339054_16005511e-46Medicago truncatula metal transport protein (ZIP1) mRNA, complete cds.731009100 (3)gb:AY339054_16005515e-59Medicago truncatula metal transport protein (ZIP1) mRNA, complete cds.
JMSF032G05Sequence678003467 (2)gb:AY339054_16005518e-21Medicago truncatula metal transport protein (ZIP1) mRNA, complete cds.754009100 (3)gb:AY339054_16005516e-63Medicago truncatula metal transport protein (ZIP1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF019B14- G
                      ____________________________________________________________
consensus G
 
. : . : . : . : . : . :
JMFF019B14- TCAAAGATGCTGCTGCTGCAGATCACATGCACAGACATGGAGCAGCAGCAGCAGCCGTGT
                      ____________________________________________________________
consensus TCAAAGATGCTGCTGCTGCAGATCACATGCACAGACATGGAGCAGCAGCAGCAGCCGTGT
 
. : . : . : . : . : . :
JMFF019B14- ATCTCGATCCCCCGCCATCTAATAATGAATTAGTGCACCTATCGGATCGAATACGACAGC
                      ____________________________________________________________
consensus ATCTCGATCCCCCGCCATCTAATAATGAATTAGTGCACCTATCGGATCGAATACGACAGC
 
. : . : . : . : . : . :
JMFF019B14- GCGTCGTATCGCAGGTAAGTTACCTAGCTAGCTTCCTTCTTACTCCGTATTATTTAATTT
                      ____________________________________________________________
consensus GCGTCGTATCGCAGGTAAGTTACCTAGCTAGCTTCCTTCTTACTCCGTATTATTTAATTT
 
. : . : . : . : . : . :
JMFF019B14- AATTTGTATATTAATTGCTTGGATCGTATATATTCATACCTAGCTGCTACCTTGTTATTA
rJMSF032G05+ A
rJMFF019B14+ A
                      ____________________________________________________________
consensus AATTTGTATATTAATTGCTTGGATCGTATATATTCATACCTAGCTGCTACCTTGTTATTA
 
. : . : . : . : . : . :
JMFF019B14- GGTACTGGAGCTGGGAATTGTGGTTCATTCAGTCATAATAGGATTGTGCTTGGGTACTTC
rJMSF032G05+ GGTACTGGAGCTGGGAATTGTGGTTCATTCAGTCATAATAGGATTGTGCTTGGGTACTTC
rJMFF019B14+ GGTACTGGAGCTGGGAATTGTGGTTCATTCAGTCATAATAGGATTGTGCTTGGGTACTTC
                      ____________________________________________________________
consensus GGTACTGGAGCTGGGAATTGTGGTTCATTCAGTCATAATAGGATTGTGCTTGGGTACTTC
 
. : . : . : . : . : . :
JMFF019B14- ACAAACCCGTGAAACAATAAGACCTTTGTTAGTTGCTTTGTCATTCCACCAGTTCTTTGA
rJMSF032G05+ ACAAACCCGTGAAACAATAAGACCTTTGTTAGTTGCTTTGTCATTCCACCAGTTCTTTGA
rJMFF019B14+ ACAAACCCGTGAAACAATAAGACCTTTGTTAGTTGCTTTGTCATTCCACCAGTTCTTTGA
                      ____________________________________________________________
consensus ACAAACCCGTGAAACAATAAGACCTTTGTTAGTTGCTTTGTCATTCCACCAGTTCTTTGA
 
. : . : . : . : . : . :
JMFF019B14- AGGGATGGGACTTGGAGGCTGCATCGCGCAGGCAAAATTCAAGTCTGTATCTACAGCAGT
rJMSF032G05+ AGGGATGGGACTTGGAGGCTGCATCGCGCAGGCAAAATTCAAGTCTGTATCTACAGCAGT
rJMFF019B14+ AGGGATGGGACTTGGAGGCTGCATCGCGCAGGCAAAATTCAAGTCTGTATCTACAGCAGT
                      ____________________________________________________________
consensus AGGGATGGGACTTGGAGGCTGCATCGCGCAGGCAAAATTCAAGTCTGTATCTACAGCAGT
 
. : . : . : . : . : . :
JMFF019B14- GATGGCAGTATTTTTTTCCCTGACCACCCCAGTTGGGATTGCAACCGGGATCGGGATATC
rJMSF032G05+ GATGGCAGTATTTTTTTCCCTGACCACCCCAGTTGGGATTGCAACCGGGATCGGGATATC
rJMFF019B14+ GATGGCAGTATTTTTTTCCCTGACCACCCCAGTTGGGATTGCAACCGGGATCGGGATATC
                      ____________________________________________________________
consensus GATGGCAGTATTTTTTTCCCTGACCACCCCAGTTGGGATTGCAACCGGGATCGGGATATC
 
. : . : . : . : . : . :
JMFF019B14- CAGTGTGTATAATCCACATAGCTCCACTGCACTAATTACACAAGGCGTTCTCAATTCTGC
rJMSF032G05+ CAGTGTGTATAATCCACATAGCTCCACTGCACTAATTACACAAGGCGTTCTCAATTCTGC
rJMFF019B14+ CAGTGTGTATAATCCACATAGCTCCACTGCACTAATTACACAAGGCGTTCTCAATTCTGC
                      ____________________________________________________________
consensus CAGTGTGTATAATCCACATAGCTCCACTGCACTAATTACACAAGGCGTTCTCAATTCTGC
 
. : . : . : . : . : . :
JMFF019B14- CTCCGCAGGCATCTTGATTTACATGGCTCTTGTTGATCTGCTAGCTGCTGATTTTA
rJMSF032G05+ CTCCGCAGGCATCTTGATTTACATGGCTCTTGTTGATCTGCTAGCTGCTGATTTTATGAA
rJMFF019B14+ CTCCGCAGGCATCTTGATTTACATGGCTCTTGTTGATCTGCTAGCTGCTGATTTTATGAA
                      ____________________________________________________________
consensus CTCCGCAGGCATCTTGATTTACATGGCTCTTGTTGATCTGCTAGCTGCTGATTTTATGAA
 
. : . : . : . : . : . :
rJMSF032G05+ ACCAAAGATTCAAAATAACGTCAGACTTCAGCTGGGGGGCCATGTTTCCCTTGTTCTAGG
rJMFF019B14+ ACCAAAGATTCAAAATAACGTCAGACTTCAGCTGGGGGGCCATGTTTCCCTTGTTCTAGG
                      ____________________________________________________________
consensus ACCAAAGATTCAAAATAACGTCAGACTTCAGCTGGGGGGCCATGTTTCCCTTGTTCTAGG
 
. : . : . : . : . : . :
rJMSF032G05+ AGCTGGAAGTATGTCTGTATTGGCCATGTGGGCCTGATGGGATGGATGATCTTATTCATT
rJMFF019B14+ AGCTGGAAGTATGTCTGTATTGGCCATGTGGGCCTGATGGGATGGATGATCTTATTCATT
                      ____________________________________________________________
consensus AGCTGGAAGTATGTCTGTATTGGCCATGTGGGCCTGATGGGATGGATGATCTTATTCATT
 
. : . : . : . : . : . :
rJMSF032G05+ CAATTCCCTTCCCCCTCAGGCCTCAGCTCACTGTTACGTACTTTCTCCATCATGTCCTCT
rJMFF019B14+ CAATTCCCTTCCCCCTCAGGCCTCAGCTCACTGTTACGTACTTTCTCCATCATGTCCTCT
                      ____________________________________________________________
consensus CAATTCCCTTCCCCCTCAGGCCTCAGCTCACTGTTACGTACTTTCTCCATCATGTCCTCT
 
. : . : . : . : . : . :
rJMSF032G05+ GTCTCATCTACCTCTATGCG
rJMFF019B14+ GTCTCATCTACCTCTATGCGTGATTGCAGTGTCATCCATCTGTAATATAAATAAATAAAT
                      ____________________________________________________________
consensus GTCTCATCTACCTCTATGCGTGATTGCAGTGTCATCCATCTGTAATATAAATAAATAAAT