Previous Contig 009098:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019B08Sequence585000972 (5)gb:AY139764_15823844e-30Arabidopsis thaliana AT5g42220/K5J14_2 mRNA, complete cds.>gb:BT006364_1639251 A508009098 (3)
JMFS167A09Sequence603009098 (3)gb:AY139764_15823843e-06Arabidopsis thaliana AT5g42220/K5J14_2 mRNA, complete cds.>gb:BT006364_1639251 A
JMSF001A16Sequence229000972 (5)721009098 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS167A09- GACATTACAAATGGGTCAAACACCAGATAATGCTGTGGTGAATGCGGGACCTGCTGTTTT
                      ____________________________________________________________
consensus GACATTACAAATGGGTCAAACACCAGATAATGCTGTGGTGAATGCGGGACCTGCTGTTTT
 
. : . : . : . : . : . :
JMFS167A09- TGTTTCTGCAACTGGGACCAATCCGATAATGGTTCAGCCACAACCTTTTCAAGCAGGCAC
                      ____________________________________________________________
consensus TGTTTCTGCAACTGGGACCAATCCGATAATGGTTCAGCCACAACCTTTTCAAGCAGGCAC
 
. : . : . : . : . : . :
JMFS167A09- TGGAATTGGCGCAATTCCCCTTGGATCTGTACATGGCTCTGGAATTTCTGGGGGCTCTGT
                      ____________________________________________________________
consensus TGGAATTGGCGCAATTCCCCTTGGATCTGTACATGGCTCTGGAATTTCTGGGGGCTCTGT
 
. : . : . : . : . : . :
JMFS167A09- CGGTTCTGGTTTCATTCCTAGAAATATTGACATCAGAATACGAACAGGTGCATATATGCC
                      ____________________________________________________________
consensus CGGTTCTGGTTTCATTCCTAGAAATATTGACATCAGAATACGAACAGGTGCATATATGCC
 
. : . : . : . : . : . :
JMFS167A09- AAGCATTGTTAACAGAAGAGATCCAACTGGTCCCCAGACTCTGGGGCAAGCTGCGCCGCC
                      ____________________________________________________________
consensus AAGCATTGTTAACAGAAGAGATCCAACTGGTCCCCAGACTCTGGGGCAAGCTGCGCCGCC
 
. : . : . : . : . : . :
JMFS167A09- TGGGGCTCCTAATGTTGAAAATTCGACTCAAGGCACTGAAGGTAATAGAAGCTCTACCAC
                      ____________________________________________________________
consensus TGGGGCTCCTAATGTTGAAAATTCGACTCAAGGCACTGAAGGTAATAGAAGCTCTACCAC
 
. : . : . : . : . : . :
JMFS167A09- CAGGGGGGTGGAGGTGAGGGTACTTCCTATTAGGACTTTGGTTGCCGCAGTTCCTGCTTC
                      ____________________________________________________________
consensus CAGGGGGGTGGAGGTGAGGGTACTTCCTATTAGGACTTTGGTTGCCGCAGTTCCTGCTTC
 
. : . : . : . : . : . :
JMFS167A09- TGTTGGACGTGCAGCAGCTTCTGATTCGGCTCGAGGTTCTATGGGGATATTCAGTCCAGT
rJMSF001A16+ GATATTCAGTCCAGT
                      ____________________________________________________________
consensus TGTTGGACGTGCAGCAGCTTCTGATTCGGCTCGAGGTTCTATGGGGATATTCAGTCCAGT
 
. : . : . : . : . : . :
JMFS167A09- TTTAGGTAGAGTTCAGCATCTCAGTTCTGAAAATGCTAATAATTCAAGTGCTGCTTCACA
rJMSF001A16+ TTTAGGTAGAGTTCAGCATCTCAGTTCTGAAAATGCTAATAATTCAAGTGCTGCTTCACA
                      ____________________________________________________________
consensus TTTAGGTAGAGTTCAGCATCTCAGTTCTGAAAATGCTAATAATTCAAGTGCTGCTTCACA
 
. : . : . : . : . : . :
JMFS167A09- AGGATCTCATCAAAACCATCCCCACAATGTTGAGATTGGACAACAGTCAATCCCTGATGC
rJMSF001A16+ AGGATCTCATCAAAACCATCCCCACAATGTTGAGATTGGACAACAGTCAATCCCTGATGC
                      ____________________________________________________________
consensus AGGATCTCATCAAAACCATCCCCACAATGTTGAGATTGGACAACAGTCAATCCCTGATGC
 
. : . : . : . : . : . :
JMFS167A09- TGC
rJMSF001A16+ TGCAGGACAGAGAAACGTTAGACTATTTGGAGTTAACGTCAATCGTAGCTCAACTGGTGA
                      ____________________________________________________________
consensus TGCAGGACAGAGAAACGTTAGACTATTTGGAGTTAACGTCAATCGTAGCTCAACTGGTGA
 
. : . : . : . : . : . :
rJMSF001A16+ AATGTCGAGTAGAGTTGAGCACTTTTTGAGAGCGTTATTCCCCGGTGAGCAGCTTCAAGT
rJMFF019B08+ CGTTATTCCCCGGTGANCAGCTTCAAGT
                      ____________________________________________________________
consensus AATGTCGAGTAGAGTTGAGCACTTTTTGAGAGCGTTATTCCCCGGTGAGCAGCTTCAAGT
 
. : . : . : . : . : . :
rJMSF001A16+ TGAGAATGTCAGTGTCCATGGCATGAATACACATTCCGCTGCTGGTGAGAGCGTTGCAAC
rJMFF019B08+ TGAGAATGTCAGTGTCCATGGCATGAATNCACATTCCGCTGCTGGTGAGAGCGTTGCAAC
                      ____________________________________________________________
consensus TGAGAATGTCAGTGTCCATGGCATGAATACACATTCCGCTGCTGGTGAGAGCGTTGCAAC
 
. : . : . : . : . : . :
rJMSF001A16+ CCAAAATACTGCTGCTTCTCAAGAGACGGGAGCAATAGAAGATGGAGTGTTTTTATCCAA
rJMFF019B08+ CCAAAATACTGCTGCTTCTCAAGAGACGGGAGCAATAGAAGATGGAGTGTTTTTATCCAA
                      ____________________________________________________________
consensus CCAAAATACTGCTGCTTCTCAAGAGACGGGAGCAATAGAAGATGGAGTGTTTTTATCCAA
 
. : . : . : . : . : . :
rJMSF001A16+ TATACTACGTCACATCTTGCCCATTGTATCTGAAACCACAGAAACGGTGCCTAATATCCC
rJMFF019B08+ TATACTACGTCACATCTTGCCCATTGTATCTGAAACCACAGAAACGGTGCCTAATATCCC
                      ____________________________________________________________
consensus TATACTACGTCACATCTTGCCCATTGTATCTGAAACCACAGAAACGGTGCCTAATATCCC
 
. : . : . : . : . : . :
rJMSF001A16+ ACCCACTGAACAAGTAGATGTTGCTGAGGATAGAAGTACACAAGCTTCAACACAGGCTCA
rJMFF019B08+ ACCCACTGAACAAGTAGATGTTGCTGAGGATAGAAGTACACAAGCTTCAACACAGGCTCA
                      ____________________________________________________________
consensus ACCCACTGAACAAGTAGATGTTGCTGAGGATAGAAGTACACAAGCTTCAACACAGGCTCA
 
. : . : . : . : . : . :
rJMSF001A16+ AGATAATGTAGAGCAAGCAACCTCCTCTCGGCGTCGACGTGACCCTCGATTGCAACCAAG
rJMFF019B08+ AGATAATGTAGAGCAAGCAACCTCCTCTCGGCGTCGACGTGACCCTCGATTGCAACCAAG
                      ____________________________________________________________
consensus AGATAATGTAGAGCAAGCAACCTCCTCTCGGCGTCGACGTGACCCTCGATTGCAACCAAG
 
. : . : . : . : . : . :
rJMSF001A16+ CTCAAAACGTCAAAAGCGGGAGTGATTTCAAGAGTTGCTGAGGTGGACCGATTGCAGCTG
rJMFF019B08+ CTCAAAACGTCAAAAGCGGGAGTGATTTCAAGAGTTGCTGAGGTGGACCGATTGCAGCTG
                      ____________________________________________________________
consensus CTCAAAACGTCAAAAGCGGGAGTGATTTCAAGAGTTGCTGAGGTGGACCGATTGCAGCTG
 
. : . : . : . : . : . :
rJMSF001A16+ GATAATATGCTTATGGATATGATATTTTGATTTGTATTATAGAACTGAAAACTCTGCTTT
rJMFF019B08+ GATAATATGCTTATGGATATGATATTTTGATTTGTATTATAGAACTGAAAACTCTGCTTT
                      ____________________________________________________________
consensus GATAATATGCTTATGGATATGATATTTTGATTTGTATTATAGAACTGAAAACTCTGCTTT
 
. : . : . : . : . : . :
rJMSF001A16+ GGCTGCAAGGGTTTCTGGGACTCTTTGCGCGAATCTGAGGAACATT
rJMFF019B08+ GGCTGCAAGGGTTTCTGGGACTCTTTGCGCGAATCTGAGGAACATTTTTCTTCTGAGTAT
                      ____________________________________________________________
consensus GGCTGCAAGGGTTTCTGGGACTCTTTGCGCGAATCTGAGGAACATTTTTCTTCTGAGTAT