Previous Contig 009096:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013J21Sequence601000970 (5)pir|D86315|D863155e-48hypothetical protein T10F20.2 [imported] - Arabidopsis thaliana>gb:AE005172_8907702009096 (3)gb:AY084456_15695462e-51Arabidopsis thaliana clone 108615 mRNA, complete sequence.
JMFF019B03Sequence512000970 (5)pir|D86315|D863154e-37hypothetical protein T10F20.2 [imported] - Arabidopsis thaliana>gb:AE005172_8907725009096 (3)gb:AY084456_15695465e-50Arabidopsis thaliana clone 108615 mRNA, complete sequence.
JMSF050H07Sequence710000970 (5)pir|D86315|D863151e-60hypothetical protein T10F20.2 [imported] - Arabidopsis thaliana>gb:AE005172_8907750009096 (3)gb:AY084456_15695463e-62Arabidopsis thaliana clone 108615 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF050H07+ GGGCCAGCN
                      ____________________________________________________________
consensus GGGCCAGCN
 
. : . : . : . : . : . :
rJMSF050H07+ ATTTCTTCTACACGTACCAGTTCAACAACGTGAATGGGGTTCTGTTCAACCTGAGAACGC
rJMFF013J21+ AACGC
rJMFF019B03+ AACGC
                      ____________________________________________________________
consensus ATTTCTTCTACACGTACCAGTTCAACAACGTGAATGGGGTTCTGTTCAACCTGAGAACGC
 
. : . : . : . : . : . :
rJMSF050H07+ GGGGTTTGAACACTGTGTTCTACTTTGCCGCGCAGATGATCGGGTCAGTTTTGATTGGTT
rJMFF013J21+ GGGGTTTGAACACTGTGTTCTACTTTGCCGCGCAGATGATCGGGTCAGTTTTGATTGGTT
rJMFF019B03+ GGGGTTTGAACACTGTGTTNTACTTTGCCGCGCAGATGATCGGGTCAGTTTTGATTGGTT
                      ____________________________________________________________
consensus GGGGTTTGAACACTGTGTTCTACTTTGCCGCGCAGATGATCGGGTCAGTTTTGATTGGTT
 
. : . : . : . : . : . :
rJMSF050H07+ TGGTGATGGATTCGAGCTTCAAGAGGCGGAGAACCAGAGGGGTGGTCGGGATTGCCACTG
rJMFF013J21+ TGGTGATGGATTCGAGCTTCAAGAGGCGGAGAACCAGAGGGGTGGTCGGGATTGCCACTG
rJMFF019B03+ TGGTGATGGATTCGAGCTTCAAGAGGCGGAGAACCAGAGGGGTGGTCGGGATTGCCACTG
                      ____________________________________________________________
consensus TGGTGATGGATTCGAGCTTCAAGAGGCGGAGAACCAGAGGGGTGGTCGGGATTGCCACTG
 
. : . : . : . : . : . :
rJMSF050H07+ TCGCCGCCGTGGGGACGGCGATTTGGGGCGGAGGGCTAGCCAAACAGCTTGATTACAGCC
rJMFF013J21+ TCGCCGCCGTGGGGACGGCGATTTGGGGCGGAGGGCTAGCCAAACAGCTTGATTACAGCC
rJMFF019B03+ TCGCCGCCGTGGGGACGGCGATTTGGGGCGGAGGGCTAGCCAAACAGCTTGATTACAGCC
                      ____________________________________________________________
consensus TCGCCGCCGTGGGGACGGCGATTTGGGGCGGAGGGCTAGCCAAACAGCTTGATTACAGCC
 
. : . : . : . : . : . :
rJMSF050H07+ GGGAACACCCGCCGGAACACAGGCTGGATTTCAAGGATGGGGTGGAGTTTGCAGGGCCAT
rJMFF013J21+ GGGAACACCCGCCGGAACACAGGCTGGATTTCAAGGATGGGGTGGAGTTTGCAGGGCCAT
rJMFF019B03+ GGGAACACCCGCCGGAACACAGGCTGGATTTCAAGGATGGGGTGGAGTTTGCAGGGCCAT
                      ____________________________________________________________
consensus GGGAACACCCGCCGGAACACAGGCTGGATTTCAAGGATGGGGTGGAGTTTGCAGGGCCAT
 
. : . : . : . : . : . :
rJMSF050H07+ TTGTGTTGTATTTCAGCTATGGCTTGCTTGATTCCATGTTCCAAAGCATGGTCTATTGGG
rJMFF013J21+ TTGTGTTGTATTTCAGCTATGGCTTGCTTGATTCCATGTTCCAAAGCATGGTCTATTGGG
rJMFF019B03+ TTGTGTTGTATTTCAGCTATGGCTTGCTTGATTCCATGTTCCAAAGCATGGTCTATTGGG
                      ____________________________________________________________
consensus TTGTGTTGTATTTCAGCTATGGCTTGCTTGATTCCATGTTCCAAAGCATGGTCTATTGGG
 
. : . : . : . : . : . :
rJMSF050H07+ TCATCGGAGCCTTAGCAGATGATTCCGAAATCCTTAGCAGGTATGCTGGATTCTACAAAG
rJMFF013J21+ TCATCGGAGCCTTAGCAGATGATTCCGAAATCCTTAGCAGGTATGCTGGATTCTACAAAG
rJMFF019B03+ TCATCGGAGCCTTAGCAGATGATTCCGAAATCCTTAGCAGGTATGCTGGATTCTACAAAG
                      ____________________________________________________________
consensus TCATCGGAGCCTTAGCAGATGATTCCGAAATCCTTAGCAGGTATGCTGGATTCTACAAAG
 
. : . : . : . : . : . :
rJMSF050H07+ GTGTGCAGAGTGCAGGGGCAGCAGTGGCCTGGGAAGTGGATACAAAGAAGGTATCATTCC
rJMFF013J21+ GTGTGCAGAGTGCAGGGGCAGCAGTGGCCTGGGAAGTGGATACAAAGAAGGTATCATTCC
rJMFF019B03+ GTGTGCAGAGTGCAGGGGCAGCAGTGGCCTGGGAAGTGGATACAAAGAAGGTATCATTCC
                      ____________________________________________________________
consensus GTGTGCAGAGTGCAGGGGCAGCAGTGGCCTGGGAAGTGGATACAAAGAAGGTATCATTCC
 
. : . : . : . : . : . :
rJMSF050H07+ TTAACCAATTCATAGCAAATTGGGCACTAACTACCATAAGCTATCCCCTTCTGGTGATTC
rJMFF013J21+ TTAACCAATTCATAGCAAATTGGGCACTAACTACCATAAGCTATCCCCTTCTGGTGATTC
rJMFF019B03+ TTAACCAATTCATAGCAAATTGGGCACTAACTACCATAAGCTATCCCCTTCTGGTGATTC
                      ____________________________________________________________
consensus TTAACCAATTCATAGCAAATTGGGCACTAACTACCATAAGCTATCCCCTTCTGGTGATTC
 
. : . : . : . : . : . :
rJMSF050H07+ TTGTATTGTTAGCTGTTAAGGATGATGACGATGACGACAAAGCTGAGGACAATAAATATA
rJMFF013J21+ TTGTATTGTTAGCTGTTAAGGATGATGACGATGACGACAAAGCTGAGGACAATAGATATA
rJMFF019B03+ TTGTATTGTTAGCTGTTAAGGATGATGACGATGACGACAAAGCTGAGGACAATAAATATA
                      ____________________________________________________________
consensus TTGTATTGTTAGCTGTTAAGGATGATGACGATGACGACAAAGCTGAGGACAATAAATATA
 
. : . : . : . : . : . :
rJMSF050H07+ CTCAATTTACTGCATCATAGTTCAGTAGTTAAGTTACGTTACGTTGTTGCATGGCTGGCT
rJMFF013J21+ CTCAATTTACTGCATCATAGTTCAGTAGTTAAGTTACGTTACGTTGTTGCATGGCTGGCT
rJMFF019B03+ CTCAATTTACTGCATCATAGTTCAGTAGTTAAGTTACGTTACGTTGTTGCATGGCTGGCT
                      ____________________________________________________________
consensus CTCAATTTACTGCATCATAGTTCAGTAGTTAAGTTACGTTACGTTGTTGCATGGCTGGCT
 
. : . : . : . : . : . :
rJMSF050H07+ CCAACAACATAGGAGTTTCAGAGTTACTTAAAAACATGATAATGATCATTCATGGTTCAT
rJMFF013J21+ CCAACAACATAGGAGTTTCAGAGTTACTTAAAAACATGATAATGATCATTCATGGTTCAT
rJMFF019B03+ CCAACAACATAGGAGTTTCAGAGTTACTTAAAAACATGATAATGATCATTCATGGTTCAT
                      ____________________________________________________________
consensus CCAACAACATAGGAGTTTCAGAGTTACTTAAAAACATGATAATGATCATTCATGGTTCAT
 
. : . : . : . : . : . :
rJMSF050H07+ GTGTTCTGTTAATGTCGTTTT
rJMFF013J21+ GTGTTCTGTTAATGTCGTTTTGTTCT
rJMFF019B03+ GTGTTCTGTTAATGTCGTTTTGTTCTGTAAAATAAAGCAAAACCACATCTGCAAAGAAGT
                      ____________________________________________________________
consensus GTGTTCTGTTAATGTCGTTTTGTTCTGTAAAATAAAGCAAAACCACATCTGCAAAGAAGT