Previous Contig 009091:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018O21Sequence819009091 (2)gb:CQ873571_1454729e-100Sequence 1 from Patent EP1457562.>gb:CQ873574_1454730 Sequence 1 from Patent EP1
JMSF026I24Sequence656006387 (4)gb:NTA243437_16912783e-74Nicotiana rustica mRNA for quinolinate phosphoribosyltransferase, variety SC58.754009091 (2)gb:CQ873571_14547293e-91Sequence 1 from Patent EP1457562.>gb:CQ873574_1454730 Sequence 1 from Patent EP1

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018O21+ GCTTAATTTTATGCAGAGAATGAGCGGAATTGCTACACT
                      ____________________________________________________________
consensus GCTTAATTTTATGCAGAGAATGAGCGGAATTGCTACACT
 
. : . : . : . : . : . :
rJMSF026I24+ GGCGATGGCAGATGCTGCNANTCCGGCATATATCTTGGAGACGAGAAAAACTGC
rJMFF018O21+ GACTAAGGCGATGGCAGATGCTGCAAATCCGGCATATATCTTGGAGACGAGAAAAACTGC
                      ____________________________________________________________
consensus GACTAAGGCGATGGCAGATGCTGCAAATCCGGCATATATCTTGGAGACGAGAAAAACTGC
 
. : . : . : . : . : . :
rJMSF026I24+ TCCTGGCTTGCGTTTAATCGATAAGTGGGCGGTATTAATCGGTGGTGGCCAAAACCACAG
rJMFF018O21+ TCCTGGCTTGCGTTTAATCGATAAGTGGGCGGTATTAATCGGTGGTGGCCAAAACCACAG
                      ____________________________________________________________
consensus TCCTGGCTTGCGTTTAATCGATAAGTGGGCGGTATTAATCGGTGGTGGCCAAAACCACAG
 
. : . : . : . : . : . :
rJMSF026I24+ AATGGGTTTATTTGATATGGTGATGATAAAAGACAATCACATCTCAACAGCGGGAGGTGT
rJMFF018O21+ AATGGGTTTATTTGATATGGTGATGATAAAAGACAATCACATCTCAACAGCGGGAGGTGT
                      ____________________________________________________________
consensus AATGGGTTTATTTGATATGGTGATGATAAAAGACAATCACATCTCAACAGCGGGAGGTGT
 
. : . : . : . : . : . :
rJMSF026I24+ CAGTGAAGCCTTAAAATCTGTCGACCAGTATCTCGAGCAAAATAGCCTTCAAATGGGGGT
rJMFF018O21+ CAGTGAAGCCTTAAAATCTGTCGACCAGTATCTCGAGCAAAATAGCCTTCAAATGGGGGT
                      ____________________________________________________________
consensus CAGTGAAGCCTTAAAATCTGTCGACCAGTATCTCGAGCAAAATAGCCTTCAAATGGGGGT
 
. : . : . : . : . : . :
rJMSF026I24+ TGAGATTGAAACCCGGACACTTGAGGAAGTGCACGAGGTGTTACGATATGCGTCTAAAAC
rJMFF018O21+ TGAGATTGAAACCCGGACACTTGAGGAAGTGCACGAGGTGTTACGATATGCGTCTAAAAC
                      ____________________________________________________________
consensus TGAGATTGAAACCCGGACACTTGAGGAAGTGCACGAGGTGTTACGATATGCGTCTAAAAC
 
. : . : . : . : . : . :
rJMSF026I24+ AAAGACTTCATTGACTAGAATAATGCTGGACAATATGATCGTTCCACTGCCTAATAGGGA
rJMFF018O21+ AAAGACTTCATTGACTAGAATAATGCTGGACAATATGATCGTTCCACTGCCTAATAGGGA
                      ____________________________________________________________
consensus AAAGACTTCATTGACTAGAATAATGCTGGACAATATGATCGTTCCACTGCCTAATAGGGA
 
. : . : . : . : . : . :
rJMSF026I24+ TATTGATGTGTCCATGCTCAAGGAAGCTGTAGATTTGATCGGTGGGAGATTCGAGACCGA
rJMFF018O21+ TATTGATGTGTCCATGCTCAAGGAAGCTGTAGATTTGATCGGTGGGAGATTCGAGACCGA
                      ____________________________________________________________
consensus TATTGATGTGTCCATGCTCAAGGAAGCTGTAGATTTGATCGGTGGGAGATTCGAGACCGA
 
. : . : . : . : . : . :
rJMSF026I24+ GGCTTCTGGAAATGTTACCCTTGAGACAGTGCACAAGATTGGGCAAACTGGGGTGACCTA
rJMFF018O21+ GGCTTCTGGAAATGTTACCCTTGAGACAGTGCACAAGATTGGGCAAACTGGGGTGACCTA
                      ____________________________________________________________
consensus GGCTTCTGGAAATGTTACCCTTGAGACAGTGCACAAGATTGGGCAAACTGGGGTGACCTA
 
. : . : . : . : . : . :
rJMSF026I24+ CATATCCAGCGGTGCACTAACGCATTCTGTAAAAGCGCTCGACATTTCCCTGAAGATCGA
rJMFF018O21+ CATATCCAGCGGTGCACTAACGCATTCTGTAAAAGCGCTCGACATTTCCCTGAAGATCGA
                      ____________________________________________________________
consensus CATATCCAGCGGTGCACTAACGCATTCTGTAAAAGCGCTCGACATTTCCCTGAAGATCGA
 
. : . : . : . : . : . :
rJMSF026I24+ TACAGAGCTCGCCCTCGAAGTTGGAAGACGCACAAATCGAGCATGATCGCACTCCTCGTT
rJMFF018O21+ TACAGAGCTCGCCCTCGAAGTTGGAAGACGCACAAATCGAGCATGATCGCACTCCTCGTT
                      ____________________________________________________________
consensus TACAGAGCTCGCCCTCGAAGTTGGAAGACGCACAAATCGAGCATGATCGCACTCCTCGTT
 
. : . : . : . : . : . :
rJMSF026I24+ TTCAACGAACCGATGTTATATTCCTTTGTAATAAGTTGATAGTCACAAGAATGGAATACA
rJMFF018O21+ TTCAACGAACCGATGTTATATTCCTTTGTAATAAGTTGATAGTCACAAGAATGGAATACA
                      ____________________________________________________________
consensus TTCAACGAACCGATGTTATATTCCTTTGTAATAAGTTGATAGTCACAAGAATGGAATACA
 
. : . : . : . : . : . :
rJMSF026I24+ AATAAGAATTGGTCATATGAGCCTGCAAATTCCTTGATGATGTGCAAATTGGCAACTATG
rJMFF018O21+ AATAAGAATTGGTCATATGAGCCTGCAAATTCCTTGATGATGTGCAAATTGGCAACTATG
                      ____________________________________________________________
consensus AATAAGAATTGGTCATATGAGCCTGCAAATTCCTTGATGATGTGCAAATTGGCAACTATG
 
. : . : . : . : . : . :
rJMSF026I24+ ACTTGTTTAAGAGTTACACAACTGTAGTGGCAATTGCTCT
rJMFF018O21+ ACTTGTTTAAGAGTTACACAACTGTAGTGGCAATTGCTCTTTTAAGTANAAAGAAAGAAG
                      ____________________________________________________________
consensus ACTTGTTTAAGAGTTACACAACTGTAGTGGCAATTGCTCTTTTAAGTANAAAGAAAGAAG