Previous Contig 009089:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018N23Sequence532009089 (4)sp|P46604|HT22_ARATH7e-15Homeobox-leucine zipper protein HAT22 (HD-ZIP protein 22).>pir|T06026|T06026 hom774009089 (4)sp|P46604|HT22_ARATH3e-44Homeobox-leucine zipper protein HAT22 (HD-ZIP protein 22).>pir|T06026|T06026 hom
JMFF028D03Sequence551009089 (4)sp|P46604|HT22_ARATH5e-23Homeobox-leucine zipper protein HAT22 (HD-ZIP protein 22).>pir|T06026|T06026 hom706009089 (4)sp|P46604|HT22_ARATH2e-44Homeobox-leucine zipper protein HAT22 (HD-ZIP protein 22).>pir|T06026|T06026 hom

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018N23- ATCACCACTACAAACACCTCAAAAGTTGCATTAAAAAATAAAATGGGATTAGAGGACAT
JMFF028D03- ATCACCACTACAAACACCTCAAAAGTTGCATTAAAAAATAAAATGGGATTAGAGGACAT
                      ____________________________________________________________
consensus ATCACCACTACAAACACCTCAAAAGTTGCATTAAAAAATAAAATGGGATTAGAGGACAT
 
. : . : . : . : . : . :
JMFF018N23- CTACAGCACCAGACTCACTCTCAGCCTAGGATCCGATGATCTTCATCGCCAGGTTTATCG
JMFF028D03- CTACAGCACCAGACTCACTCTCAGCCTAGGATCCGATGATCTTCATCGCCAGGTTTATCG
                      ____________________________________________________________
consensus CTACAGCACCAGACTCACTCTCAGCCTAGGATCCGATGATCTTCATCGCCAGGTTTATCG
 
. : . : . : . : . : . :
JMFF018N23- GCAAAACAAGAGATCAAAGCCGCCTTCCCCGATATCCGACAACTATCTGCCGTCCCTCTC
JMFF028D03- GCAAAACAAGAGATCAAAGCCGCCTTCCCCGATATCCGACAACTATCTGCCGTCCCTCTC
                      ____________________________________________________________
consensus GCAAAACAAGAGATCAAAGCCGCCTTCCCCGATATCCGACAACTATCTGCCGTCCCTCTC
 
. : . : . : . : . : . :
JMFF018N23- GCTGGGATTGCCGTGGGAAGTGAAGTTTGAAGCTATGAACGACGGGAGCACTGCGATGAT
JMFF028D03- GCTGGGATTGCCGTGGGAAGTGAAGTTTGAAGCTATGAACGACGGGAGCACTGCGATGAT
rJMFF028D03+ GCGATGAT
rJMFF018N23+ GATTGCCGTGGGAAGTGAAGTTTGAAGCTATGAACGACGGGAGCACTGCGATGAT
                      ____________________________________________________________
consensus GCTGGGATTGCCGTGGGAAGTGAAGTTTGAAGCTATGAACGACGGGAGCACTGCGATGAT
 
. : . : . : . : . : . :
JMFF018N23- GATGAACTGTTGCCTGCAGCAGGCTTCTCCGGCGGCGGCGCCGTCGTCGTTCTCGGACTC
JMFF028D03- GATGAACTGTTGCCTGCAGCAGGCTTCTCCGGCGGCGGCGCCGTCGTCGTTCTCGGACTC
rJMFF028D03+ GATGAACTGTTGCCTGCAGCAGGCTTNTCCGGCGGCGGCGCCGTCGTCGTTCTCGGACTC
rJMFF018N23+ GATGAACTGTTGCCTGCAGCAGGCTTCTCCGGCGGCGGCGCCGTCGTCGTTCTCGGACTC
                      ____________________________________________________________
consensus GATGAACTGTTGCCTGCAGCAGGCTTCTCCGGCGGCGGCGCCGTCGTCGTTCTCGGACTC
 
. : . : . : . : . : . :
JMFF018N23- GAGTTTGAAGAGGGAACGAGAGATCAGCGGCGGCGAAGAAGATGAACTTGAGGCGGCGGA
JMFF028D03- GAGTTTGAAGAGGGAACGAGAGATCAGCGGCGGCGAAGAAGATGAACTTGAGGCGGCGGA
rJMFF028D03+ GAGTTTGAAGAGGGAACGAGAGATCAGCGGCGGCGAAGAAGATGAACTTGAGGCGGCGGA
rJMFF018N23+ GAGTTTGAAGAGGGAACGAGAGATCAGCGGCGGCGAAGAAGATGAACTTGAGGCGGCGGA
                      ____________________________________________________________
consensus GAGTTTGAAGAGGGAACGAGAGATCAGCGGCGGCGAAGAAGATGAACTTGAGGCGGCGGA
 
. : . : . : . : . : . :
JMFF018N23- GAAAGGGTCTCCCTGCAGGGATGAGTACCAGGATGATGAAGAGGTTGTCGGTACGAGGAA
JMFF028D03- GAAAGGGTCTCCCTGCAGGGATGAGTACCAGGATGATGAAGAGGTTGTCGGTACGAGGAA
rJMFF028D03+ GAAAGGGTCTCCCTGCAGGGATGAGTACCAGGATGATGAAGAGGTTGTCGGTACGAGGAA
rJMFF018N23+ GAAAGGGTCTCCCTGCAGGGATGAGTACCAGGATGATGAAGAGGTTGTCGGTACGAGGAA
                      ____________________________________________________________
consensus GAAAGGGTCTCCCTGCAGGGATGAGTACCAGGATGATGAAGAGGTTGTCGGTACGAGGAA
 
. : . : . : . : . : . :
JMFF018N23- GAAACTTAGGCTCACCAAACAACAGTCGATTGTCTTGGAAGACAGCTTCAAACAACACAC
JMFF028D03- GAAACTTAGGCTCACCAAACAACAGTCGATTGTCTTGGAAGACAGCTTCAAACAACACAC
rJMFF028D03+ GAAACTTAGGCTCACCAAACAACAGTCGATTGTCTTGGAAGACAGCTTCAAACAACACAC
rJMFF018N23+ GAAACTTAGGCTCACCAAACAACAGTCGATTGTCTTGGAAGACAGCTTCAAACAACACAC
                      ____________________________________________________________
consensus GAAACTTAGGCTCACCAAACAACAGTCGATTGTCTTGGAAGACAGCTTCAAACAACACAC
 
. : . : . : . : . : . :
JMFF018N23- CACTCTCAATTCTAAACAGGAAGCAAGAATTGGCGAGAAGGCTAAATTTACGG
JMFF028D03- CACTCTCAATTCTAAACA-GAAGCAAGAATTGGCGAGAAGGCTAAATTTACGGCCGCGAC
rJMFF028D03+ CACTCTCAATTCTAAACA-GAAGCAAGAATTGGCGAGAAGGCTAAATTTACGGCCGCGAC
rJMFF018N23+ CACTCTCAATTCTAAACA-GAAGCAAGAATTGGCGAGAAGGCTAAATTTACGGCCGCGAC
                      ____________________________________________________________
consensus CACTCTCAATTCTAAACA-GAAGCAAGAATTGGCGAGAAGGCTAAATTTACGGCCGCGAC
 
. : . : . : . : . : . :
JMFF028D03- AAGTGGAAGTGTG
rJMFF028D03+ AAGTGGAAGTGTGGTTCCAGAATCGAAGAGCGAGGACGAAACTGAAGCAGACAGAAGTGG
rJMFF018N23+ AAGTGGAAGTGTGGTTCCAGAATCGAAGAGCGAGGACGAAACTGAAGCAGACAGAAGTGG
                      ____________________________________________________________
consensus AAGTGGAAGTGTGGTTCCAGAATCGAAGAGCGAGGACGAAACTGAAGCAGACAGAAGTGG
 
. : . : . : . : . : . :
rJMFF028D03+ ACTATGAAGTACTAAGGAAGTGCTACGAAACCCTCACGGATGAGAACAGAAGGCTGCAGA
rJMFF018N23+ ACTATGAAGTACTAAGGAAGTGCTACGAAACCCTCACGGATGAGAACAGAAGGCTGCAGA
                      ____________________________________________________________
consensus ACTATGAAGTACTAAGGAAGTGCTACGAAACCCTCACGGATGAGAACAGAAGGCTGCAGA
 
. : . : . : . : . : . :
rJMFF028D03+ AGGAACTGCTGGAGCTCAAAGCAGCCGCCAACCAGACAACGACGGCGGCGCCGCCGTTTC
rJMFF018N23+ AGGAACTGCTGGAGCTCAAAGCAGCCGCCAACCAGACAACGACGGCGGCGCCGCCGTTTC
                      ____________________________________________________________
consensus AGGAACTGCTGGAGCTCAAAGCAGCCGCCAACCAGACAACGACGGCGGCGCCGCCGTTTC
 
. : . : . : . : . : . :
rJMFF028D03+ ACATGGCGGCGACGCTCACCATGTGCCCTTCCTGCGAGAGGACTTACGGTGGCTCCACCG
rJMFF018N23+ ACATGGCGGCGACGCTCACCATGTGCCCTTCCTGCGAGAGGACTTACGGTGGCTCCACCG
                      ____________________________________________________________
consensus ACATGGCGGCGACGCTCACCATGTGCCCTTCCTGCGAGAGGACTTACGGTGGCTCCACCG
 
. : . : . : . : . : . :
rJMFF028D03+ ACAGCTCTGCCAAATTTTCTATCTCGGCCGGAGGAAAATCTCACCTTTTCCGATCATTCT
rJMFF018N23+ ACAGCTCTGCCAAATTTTCTATCTCGGCCGGAGGAAAATCTCACCTTTTCCGATCATTCT
                      ____________________________________________________________
consensus ACAGCTCTGCCAAATTTTCTATCTCGGCCGGAGGAAAATCTCACCTTTTCCGATCATTCT
 
. : . : . : . : . : . :
rJMFF028D03+ TGAATCCCTCCGAGGCTTGTTAGAAAGATCATATCAGAGGTCGACTTCTGTAAAATTATA
rJMFF018N23+ TGAATCCCTCCGAGGCTTGTTAGAAAGATCATATCAGAGGTCGACTTCTGTAAAATTATA
                      ____________________________________________________________
consensus TGAATCCCTCCGAGGCTTGTTAGAAAGATCATATCAGAGGTCGACTTCTGTAAAATTATA
 
. : . : . : . : . : . :
rJMFF028D03+ TTATGTTTATATATGTGTAGAGAATATCGTATTGTAAAC
rJMFF018N23+ TTATGTTTATATATGTGTAGAGAATATCGTATTGTAAACTCGAATTGATTAATTCAAAGA
                      ____________________________________________________________
consensus TTATGTTTATATATGTGTAGAGAATATCGTATTGTAAACTCGAATTGATTAATTCAAAGA