Previous Contig 009088:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018N09Sequence594004587 (2)pir|T04509|T045096e-43hypothetical protein F8F16.240 - Arabidopsis thaliana>gb:ATCHRIV75_1547063 Arabi812009088 (3)gb:AP003770_18333278e-72Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055
JMSF004B05Sequence295004577 (3)327009088 (3)gb:AP003770_18333272e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055
JMSF004D07Sequence260004587 (2)pir|T04509|T045099e-29hypothetical protein F8F16.240 - Arabidopsis thaliana>gb:ATCHRIV75_1547063 Arabi189009088 (3)gb:AP003770_18333271e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P055

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018N09+ TAAAGCATAGACCAATAGAACGCTGTATGGTTC
                      ____________________________________________________________
consensus TAAAGCATAGACCAATAGAACGCTGTATGGTTC
 
. : . : . : . : . : . :
rJMFF018N09+ ACATGCACAAGCAGCATGGATTCTTTATACCCGATGTTGAATATCTCAAGGACCCAAAAG
                      ____________________________________________________________
consensus ACATGCACAAGCAGCATGGATTCTTTATACCCGATGTTGAATATCTCAAGGACCCAAAAG
 
. : . : . : . : . : . :
rJMFF018N09+ GCTTTCTGACTTATGTTGGTCTCAAGGTTAAGAGGGACTACCTATGTTTGTATTGCAATG
                      ____________________________________________________________
consensus GCTTTCTGACTTATGTTGGTCTCAAGGTTAAGAGGGACTACCTATGTTTGTATTGCAATG
 
. : . : . : . : . : . :
rJMFF018N09+ ATAGATGCCAACCTTTCAGCAGTTTAGAAGGAGTTAGGAAGCATATGGAAGCAAAAAGTC
                      ____________________________________________________________
consensus ATAGATGCCAACCTTTCAGCAGTTTAGAAGGAGTTAGGAAGCATATGGAAGCAAAAAGTC
 
. : . : . : . : . : . :
rJMFF018N09+ ATTGTAAAGTGCACTATGGTGATGGTGGTGATGATGAAGAGGCAGAATTAGAAGAATTTT
                      ____________________________________________________________
consensus ATTGTAAAGTGCACTATGGTGATGGTGGTGATGATGAAGAGGCAGAATTAGAAGAATTTT
 
. : . : . : . : . : . :
rJMFF018N09+ ATGACTATAGCAGCAGTTATTTGGATGCAAATGGAAAAGAGCTGGTTGCATCAGATGACA
                      ____________________________________________________________
consensus ATGACTATAGCAGCAGTTATTTGGATGCAAATGGAAAAGAGCTGGTTGCATCAGATGACA
 
. : . : . : . : . : . :
rJMFF018N09+ CTAGCAGTGGAGTTGAGCTTGGAAGTGGTGGGGCTGAGCTAATTATTAAAAAGAGAACTG
                      ____________________________________________________________
consensus CTAGCAGTGGAGTTGAGCTTGGAAGTGGTGGGGCTGAGCTAATTATTAAAAAGAGAACTG
 
. : . : . : . : . : . :
rJMFF018N09+ ATGATGGAGTATCTACCATAACACTTGGATCAAGAGAGTATTTGCGATATTATCGACAAA
                      ____________________________________________________________
consensus ATGATGGAGTATCTACCATAACACTTGGATCAAGAGAGTATTTGCGATATTATCGACAAA
 
. : . : . : . : . : . :
rJMSF004B05+ CGATATTGCTCTTACTGCTGCATTAGCTTCCAGGTATA
rJMSF004D07+ CTTCCAGGTATA
rJMFF018N09+ AACTGAGGCCCACTCGCACGAACGATATTGCTCTTACTGCTGCATTAGCTTCCAGGTATA
                      ____________________________________________________________
consensus AACTGAGGCCCACTCGCACGAACGATATTGCTCTTACTGCTGCATTAGCTTCCAGGTATA
 
. : . : . : . : . : . :
rJMSF004B05+ GAAGCATGGGCCTAGCAACNGTGCAGTCGAGAGAAAACATGGTTAAGATGAAGGTGATGA
rJMSF004D07+ GAAGCATGGGCCTAGCAACCGTGCAGTCGAGAGAAAACATGGTTAAGATGAAGGTGATGA
rJMFF018N09+ GAAGCATGGGCCTAGCAACCGTGCAGTCGAGAGAAAACATGGTTAAGATGAAGGTGATGA
                      ____________________________________________________________
consensus GAAGCATGGGCCTAGCAACCGTGCAGTCGAGAGAAAACATGGTTAAGATGAAGGTGATGA
 
. : . : . : . : . : . :
rJMSF004B05+ AGGCCACGAATAGGNATGGTAACGAGGCAATGCGCACCAAGATTGGTATAAGAAATAATG
rJMSF004D07+ AGGCCATGNATAGGTATGGTAACGAGGCAATGCGCACCAAGATTGGTATAAGAAATAATG
rJMFF018N09+ AGGCCATGAATAGGTATGGTAACGAGGCAATGCGCACCAAGATTGGTATAAGAAATAATG
                      ____________________________________________________________
consensus AGGCCATGAATAGGTATGGTAACGAGGCAATGCGCACCAAGATTGGTATAAGAAATAATG
 
. : . : . : . : . : . :
rJMSF004B05+ TCATCCGAAATCTCCCCANTAACGNACCCTATTNATCCTTGTTATGTTATAAAGGTGATG
rJMSF004D07+ TCATCCGAAATCTCCCCAATAACGTACCCTATTAATCCTTGTTATGTTATAAAGG
rJMFF018N09+ TCATCCGAAATCTCCCCAATAACGTACCCTATTAATCCTTGTTATGTTATAAAGGTGATG
                      ____________________________________________________________
consensus TCATCCGAAATCTCCCCAATAACGTACCCTATTAATCCTTGTTATGTTATAAAGGTGATG
 
. : . : . : . : . : . :
rJMSF004B05+ CTAGTTGTGNAACTTTTAATGGAGTTAANGAAATATATTGGGTGGGTGTTCGTCTTTGTT
rJMFF018N09+ CTAGTTGTGAAACTTTTAATGGAGTTAAGGAAATATATTGGGTGGGTGTTCGT-TTTGTT
                      ____________________________________________________________
consensus CTAGTTGTGAAACTTTTAATGGAGTTAAGGAAATATATTGGGTGGGTGTTCGTCTTTGTT
 
. : . : . : . : . : . :
rJMSF004B05+ ACTTTTGTGCTTTCTCATTCTTGCCCTGGAATNTTTTCAGAGCGAATAT
rJMFF018N09+ ACTTTTGTGCTTTCTCATTCTTGCCTTGGAATGTTTTCAGAGAGAATATTGATAAGAATG
                      ____________________________________________________________
consensus ACTTTTGTGCTTTCTCATTCTTGCCTTGGAATGTTTTCAGAGCGAATATTGATAAGAATG