Previous Contig 009086:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011O09Sequence529009086 (8)gb:PVPFE_17029652e-31P.vulgaris pfe mRNA for ferritin.764009086 (8)gb:AF133814_17709503e-72Solanum tuberosum ferritin 1 mRNA, partial cds.
JMFF018M22Sequence528009086 (8)gb:PVPFE_17029652e-31P.vulgaris pfe mRNA for ferritin.769009086 (8)gb:AF133814_17709503e-72Solanum tuberosum ferritin 1 mRNA, partial cds.
JMFF038M10Sequence526009086 (8)gb:PVPFE_17029658e-31P.vulgaris pfe mRNA for ferritin.749009086 (8)gb:AF133814_17709501e-67Solanum tuberosum ferritin 1 mRNA, partial cds.
JMSF048D10Sequence688009086 (8)gb:AY683197_16221632e-45Vigna angularis chloroplast ferritin precursor, mRNA, complete cds; nuclear gene730009086 (8)gb:AF133814_17709503e-72Solanum tuberosum ferritin 1 mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF018M22- ACCCAGCAATCTCTACCGCTCTACCATTTCCCTTCCTGCAT
JMFF038M10- ACCCAGCAATCTCTACCGCTCTACCATTTCCCTTCCTGCAT
JMFF011O09- ACCCAGCAATCTCTACCGCTCTACCATTTCCCTTCCTGCAT
JMSF048D10- GCGCCACCCAGCAATCTCTACCGCTCTACCATTTCCCTTCCTGCAT
                      ____________________________________________________________
consensus GCGCCACCCAGCAATCTCTACCGCTCTACCATTTCCCTTCCTGCAT
 
. : . : . : . : . : . :
JMFF018M22- AGATTTCTGTTGTTCTGTTTTCTCTTTGAGTCTTGAAGATATGGCGTTTTCAGCTGTTTC
JMFF038M10- AGATTTCTGTTGTTCTGTTTTCTCTTTGAGTCTTGAAGATATGGCGTTTTCAGCTGTTTC
JMFF011O09- AGATTTCTGTTGTTCTGTTTTCTCTTTGAGTCTTGAAGATATGGCGTTTTCAGCTGTTTC
JMSF048D10- AGATTTCTGTTGTTCTGTTTTCTCTTTGAGTCTTGAAGATATGGCGTTTTCAGCTGTTTC
                      ____________________________________________________________
consensus AGATTTCTGTTGTTCTGTTTTCTCTTTGAGTCTTGAAGATATGGCGTTTTCAGCTGTTTC
 
. : . : . : . : . : . :
JMFF018M22- CCTGTGCAAGGCTTCCTGCGCTTTGCTTCCGTGCTTGACCTCTGCTTCTCCGATCGCCCC
JMFF038M10- CCTGTGCAAGGCTTCCTGCGCTTTGCTTCCGTGCTTGACCTCTGCTTCTCCGATCGCCCC
JMFF011O09- CCTGTGCAAGGCTTCCTGCGCTTTGCTTCCGTGCTTGACCTCTGCTTCTCCGATCGCCCC
JMSF048D10- CCTGTGCAAGGCTTCCTGCGCTTTGCTTCCGTGCTTGACCTCTGCTTCTCCGATCGCCCC
                      ____________________________________________________________
consensus CCTGTGCAAGGCTTCCTGCGCTTTGCTTCCGTGCTTGACCTCTGCTTCTCCGATCGCCCC
 
. : . : . : . : . : . :
JMFF018M22- TGCTTCCTCTGTTTCCGGCCTCGCGTTTCCGAGGAAGCGGAGCGGTGGATTCTCCATCTC
JMFF038M10- TGCTTCCTCTGTTTCCGGCCTCGCGTTTCCGAGGAAGCGGAGCGGTGGATTCTCCATCTC
JMFF011O09- TGCTTCCTCTGTTTCCGGCCTCGCGTTTCCGAGGAAGCGGAGCGGTGGATTCTCCATCTC
JMSF048D10- TGCTTCCTCTGTTTCCGGCCTCGCGTTTCCGAGGAAGCGGAGCGGTGGATTCTCCATCTC
rJMFF038M10+ TC
                      ____________________________________________________________
consensus TGCTTCCTCTGTTTCCGGCCTCGCGTTTCCGAGGAAGCGGAGCGGTGGATTCTCCATCTC
 
. : . : . : . : . : . :
JMFF018M22- CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
JMFF038M10- CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
JMFF011O09- CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
JMSF048D10- CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
rJMSF048D10+ CCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
rJMFF038M10+ CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
rJMFF011O09+ AGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
rJMFF018M22+ GGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
                      ____________________________________________________________
consensus CGCCGCGGCGGAGACGGCTGATGCGCCGCTCACCGGAGTGGTGTTTCAGCCGTTTGTGGA
 
. : . : . : . : . : . :
JMFF018M22- GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
JMFF038M10- GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
JMFF011O09- GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
JMSF048D10- GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
rJMSF048D10+ GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
rJMFF038M10+ GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCTCCAGGTCTCGCTTGCTCGCCAGA
rJMFF011O09+ GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
rJMFF018M22+ GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
                      ____________________________________________________________
consensus GGTTAAGAAGGATGAGCTTATGGTCCCCTCCGGTGCT-CAGGTCTCGCTTGCTCGCCAGA
 
. : . : . : . : . : . :
JMFF018M22- GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
JMFF038M10- GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
JMFF011O09- GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
JMSF048D10- GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
rJMSF048D10+ GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
rJMFF038M10+ GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
rJMFF011O09+ GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
rJMFF018M22+ GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
                      ____________________________________________________________
consensus GGTACATCGACGAGTGCGAGGCTGCGATCAATGAGCAGATCAACGTTGAATACAGCGCAT
 
. : . : . : . : . : . :
JMFF018M22- CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
JMFF038M10- CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
JMFF011O09- CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
JMSF048D10- CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
rJMSF048D10+ CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
rJMFF038M10+ CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
rJMFF011O09+ CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
rJMFF018M22+ CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
                      ____________________________________________________________
consensus CTTATGTGTATCACTCCATGTATGCATACTTCGACAGAGATAACGTTGCGCTCAAGGGCA
 
. : . : . : . : . : . :
JMFF018M22- TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
JMFF038M10- TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
JMFF011O09- TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
JMSF048D10- TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
rJMSF048D10+ TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
rJMFF038M10+ TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
rJMFF011O09+ TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
rJMFF018M22+ TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
                      ____________________________________________________________
consensus TGGCTAAATTTTTCAAGGAATCAAGTGAGGAAGAAAGGGAGCACGCTGAGAAGCTGATGA
 
. : . : . : . : . : . :
JMFF018M22- AATATCAG
JMFF038M10- AATATC
JMFF011O09- AATATCAGA
JMSF048D10- AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
rJMSF048D10+ AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
rJMFF038M10+ AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
rJMFF011O09+ AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
rJMFF018M22+ AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
                      ____________________________________________________________
consensus AATATCAGAACACCCGAGGAGGAAGGGTGAAGCTGCACTCTATTCTGATGCCTCCTTCTG
 
. : . : . : . : . : . :
JMSF048D10- AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
rJMSF048D10+ AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
rJMFF038M10+ AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
rJMFF011O09+ AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
rJMFF018M22+ AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
                      ____________________________________________________________
consensus AGTTTGACAACAACGAAAAAGGCGATGCGTTGCATGCAATGGAGCTAGCGCTTTCCTTGG
 
. : . : . : . : . : . :
JMSF048D10- AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGC
rJMSF048D10+ AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGCTAATAAGAACAATGATG
rJMFF038M10+ AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGCTAATAAGAACAATGATG
rJMFF011O09+ AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGCTAATAAGAACAATGATG
rJMFF018M22+ AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGCTAATAAGAACAATGATG
                      ____________________________________________________________
consensus AGAAGTTGGTGAATGAGAAGCTCCTGAACCTGCATGCTGTAGCTAATAAGAACAATGATG
 
. : . : . : . : . : . :
rJMSF048D10+ TTGAAATGCAAGATTTTGTTGAGAGAGAGTTCCTGGAGGAGCAGGTGGAAGCCATCAAGA
rJMFF038M10+ TTGAAATGCAAGATTTTGTTGAGAGAGAGTTCCTGGAGGAGCAGGTGGAAGCCATCAAGA
rJMFF011O09+ TTGAAATGCAAGATTTTGTTGAGAGAGAGTTCCTGGAGGAGCAGGTGGAAGCCATCAAGA
rJMFF018M22+ TTGAAATGCAAGATTTTGTTGAGAGAGAGTTCCTGGAGGAGCAGGTGGAAGCCATCAAGA
                      ____________________________________________________________
consensus TTGAAATGCAAGATTTTGTTGAGAGAGAGTTCCTGGAGGAGCAGGTGGAAGCCATCAAGA
 
. : . : . : . : . : . :
rJMSF048D10+ AAATAGCAGAGTATGTTACACAACTGAGAATGGTTGGAAAGGGACATGGAGTGTGGCACT
rJMFF038M10+ AAATAGCAGAGTATGTTACACAACTGAGAATGGTTGGAAAGGGACATGGAGTGTGGCACT
rJMFF011O09+ AAATAGCAGAGTATGTTACACAACTGAGAATGGTTGGAAAGGGACATGGAGTGTGGCACT
rJMFF018M22+ AAATAGCAGAGTATGTTACACAACTGAGAATGGTTGGAAAGGGACATGGAGTGTGGCACT
                      ____________________________________________________________
consensus AAATAGCAGAGTATGTTACACAACTGAGAATGGTTGGAAAGGGACATGGAGTGTGGCACT
 
. : . : . : . : . : . :
rJMSF048D10+ TTGATCAGAGGCTCCTCGATTAACATTAAGGGACTATATGAAGGACCGTAGGGCTGTTTC
rJMFF038M10+ TTGATCAGAGGCTCCTCGATTAACATTAAGGGACTATATGAAGGACCGTAGGGCTGTTTC
rJMFF011O09+ TTGATCAGAGGCTCCTCGATTAACATTAAGGGACTATATGAAGGACCGTAGGGCTGTTTC
rJMFF018M22+ TTGATCAGAGGCTCCTCGATTAACATTAAGGGACTATATGAAGGACCGTAGGGCTGTTTC
                      ____________________________________________________________
consensus TTGATCAGAGGCTCCTCGATTAACATTAAGGGACTATATGAAGGACCGTAGGGCTGTTTC
 
. : . : . : . : . : . :
rJMSF048D10+ TTTCCAGTAGGAAGGCTTAGATAGTTTCATCTTATGTACTANTTTCCTTCATAGNGACCA
rJMFF038M10+ TTTCCAGTAGGAAGGCTTAGATAGTTTCATCTTATGTACTATTTTCCTTAATAGAGA-CA
rJMFF011O09+ TTTCCAGTAGGAAGGCTTAGATAGTTTCATCTTATGTACTATTTTCCTTAATAGAGA-CA
rJMFF018M22+ TTTCCAGTAGGAAGGCTTAGATAGTTTCATCTTATGTACTATTTTCCTTAATAGAGA-CA
                      ____________________________________________________________
consensus TTTCCAGTAGGAAGGCTTAGATAGTTTCATCTTATGTACTATTTTCCTTAATAGAGA-CA
 
. : . : . : . : . : . :
rJMSF048D10+ TGTTAAGATGTTT
rJMFF038M10+ TGTTAAGATGTTTTGGATGTGTATTAGT
rJMFF011O09+ TGTTAAGATGTTTTGGATGTGTATTAGTTGTAATGGGGTTTGGTTATAATTAATAAA
rJMFF018M22+ TGTTAAGATGTTTTGGATGTGTATTAGTTGTAATGGGGTTTGGTTATAATTAATAAAATC
                      ____________________________________________________________
consensus TGTTAAGATGTTTTGGATGTGTATTAGTTGTAATGGGGTTTGGTTATAATTAATAAAATC