Previous Contig 009067:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018H10Sequence581000946 (2)gb:AP003313_18278722e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003803009067 (2)gb:AP003313_18278729e-66Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003
JMSF008C23Sequence392000946 (2)gb:AP003313_18278721e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003742009067 (2)gb:AP003313_18278721e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P003

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF008C23+ AATCCGGA
rJMFF018H10+ GATTATATATGGGCTCTNGTAAAATCCGGA
                      ____________________________________________________________
consensus GATTATATATGGGCTCTNGTAAAATCCGGA
 
. : . : . : . : . : . :
rJMSF008C23+ AAGTTGCTACAGCTGAAAGAACCGTGCCCGCTGTTAATGGCGTGTTTGTCACAACACAAA
rJMFF018H10+ AAGTTGCTAGAGCTGAAAGAACCGTGCCCGCTGTTAATGGCGTGTTTGTCACAACACAAA
                      ____________________________________________________________
consensus AAGTTGCTAGAGCTGAAAGAACCGTGCCCGCTGTTAATGGCGTGTTTGTCACAACACAAA
 
. : . : . : . : . : . :
rJMSF008C23+ CGCCAAAGGTCACGACTGAAACTAAAGTCGGGGAAGCCCAAAAGAGGAAAGCCACAGCGG
rJMFF018H10+ CGCCAAAGGTCACGACTGAAACTAAAGTCGGGGAAGCCCAAAAGAGGAAAGCCACAGCGG
                      ____________________________________________________________
consensus CGCCAAAGGTCACGACTGAAACTAAAGTCGGGGAAGCCCAAAAGAGGAAAGCCACAGCGG
 
. : . : . : . : . : . :
rJMSF008C23+ AACATGTATAAAGATTTCAGATGTGGCCTTAATCCTCGAGTCCTTGGCTTCCATGATCTT
rJMFF018H10+ AACATGTATAAA-------GATGTGGCCTTAATCCTCGAGTCCTTGGCTTCCATGATCTT
                      ____________________________________________________________
consensus AACATGTATAAAGATTTCAGATGTGGCCTTAATCCTCGAGTCCTTGGCTTCCATGATCTT
 
. : . : . : . : . : . :
rJMSF008C23+ CGTCTGAAGCTTCTTCTGCATACTGGCAAACGGGATATTGCTCAACATCACAACGATCGT
rJMFF018H10+ CGTCTGAAGCTTCTTCTGCATACTGGCAAACGGGATATTGCTCAACATCACAACGATCGT
                      ____________________________________________________________
consensus CGTCTGAAGCTTCTTCTGCATACTGGCAAACGGGATATTGCTCAACATCACAACGATCGT
 
. : . : . : . : . : . :
rJMSF008C23+ CGCAACAAAAGCAGCCGCGGAAGGAGCAGCACCCAAGTTCATGTACAAGATGAGCAATGC
rJMFF018H10+ CGCAACAAAAGCAGCCGCGGAAGGAGCAGCACCCAAGTTCATGTACAAGATGAGCAATGC
                      ____________________________________________________________
consensus CGCAACAAAAGCAGCCGCGGAAGGAGCAGCACCCAAGTTCATGTACAAGATGAGCAATGC
 
. : . : . : . : . : . :
rJMSF008C23+ AAAAATGACCTGAAAGGGAAGTAACCAAATCCAATGGATGAACATGAAGAAGTCCCCAAT
rJMFF018H10+ AAAAATGACCTGAAAGGGAAGTAACCAAATCCAATGGATGAACATGAAGAAGTCCCCAAT
                      ____________________________________________________________
consensus AAAAATGACCTGAAAGGGAAGTAACCAAATCCAATGGATGAACATGAAGAAGTCCCCAAT
 
. : . : . : . : . : . :
rJMSF008C23+ CCTCTCCACATCAACATTGAGGAAATTAATGACTTTCCCTGTGCTCACACTGCCATGCTT
rJMFF018H10+ CCTCTCCACATCAACATTGAGGAAATTAATGACTTTCCCTGTGCTCACACTGCCATGCTT
                      ____________________________________________________________
consensus CCTCTCCACATCAACATTGAGGAAATTAATGACTTTCCCTGTGCTCACACTGCCATGCTT
 
. : . : . : . : . : . :
rJMSF008C23+ AACTGTCAAAGACTTCTTGTAGGTCAAAGCCATGAGAGCTGCTCTCACTCTAATCCCAAT
rJMFF018H10+ AACTGTCAAAGACTTCTTGTAGGTCAAAGCCATGAGAGCTGCTCTCACTCTAATCCCAAT
                      ____________________________________________________________
consensus AACTGTCAAAGACTTCTTGTAGGTCAAAGCCATGAGAGCTGCTCTCACTCTAATCCCAAT
 
. : . : . : . : . : . :
rJMSF008C23+ GCGGTGAGCCCCAAAATACCATTGCCTTTGGGCAAGGGATTCCACCATCTTTGCAATGAA
rJMFF018H10+ GCGGTGAGCCCCAAAATACCATTGCCTTTGGGCAAGGGATTCCACCATCTTTGCAATGAA
                      ____________________________________________________________
consensus GCGGTGAGCCCCAAAATACCATTGCCTTTGGGCAAGGGATTCCACCATCTTTGCAATGAA
 
. : . : . : . : . : . :
rJMSF008C23+ GAAGATGAATGAGAGAAGCAATCCCTTTTGCCAGTTTGAATTGTCATGCTTTTCTGACAA
rJMFF018H10+ GAAGATGAATGAGAGAAGCAATCCCTTTTGCCAGTTTGAATTGTCATGCCTTTCTGACAA
                      ____________________________________________________________
consensus GAAGATGAATGAGAGAAGCAATCCCTTTTGCCAGTTTGAATTGTCATGCTTTTCTGACAA
 
. : . : . : . : . : . :
rJMSF008C23+ GAACTTCACAAAGCTTGTGATCAGCAAAGGGCCGATATAGGAAGCTATCGTGTTGGTTCC
rJMFF018H10+ GAACTTCACAAAGCTTGTGATTAGCAAAGGGCCGATATAGGAAGCTATCGTGTTGGTTCC
                      ____________________________________________________________
consensus GAACTTCACAAAGCTTGTGATTAGCAAAGGGCCGATATAGGAAGCTATCGTGTTGGTTCC
 
. : . : . : . : . : . :
rJMSF008C23+ TATACAAACGAACAGAAATTTATGTTAGTACTGTTTATGCTAAACATAAAAACCCCTCCA
rJMFF018H10+ TATACAAACGAACAGAAATTTATGTTAGTACTGTTTATGCTAAACATAAAAACCCCTCCA
                      ____________________________________________________________
consensus TATACAAACGAACAGAAATTTATGTTAGTACTGTTTATGCTAAACATAAAAACCCCTCCA
 
. : . : . : . : . : . :
rJMSF008C23+ TG-TTAACGTCCCAT
rJMFF018H10+ TGTTTAACGTCCCATTTACTTACACAAAATGAAAATAGAGAGAATAGGAATGCTAGGCAG
                      ____________________________________________________________
consensus TGTTTAACGTCCCATTTACTTACACAAAATGAAAATAGAGAGAATAGGAATGCTAGGCAG