Previous Contig 009066:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015N06Sequence549004412 (6)gb:AP005529_18535617e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070727009066 (6)gb:AP005529_18535613e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMFF018H09Sequence545004412 (6)gb:AP005529_18535617e-68Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070779009066 (6)gb:AP005529_18535615e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF011F20Sequence177005230 (2)769009066 (6)gb:AP005529_18535612e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF028L08Sequence677004412 (6)gb:AF031244_17625361e-89Arabidopsis thaliana nodulin-like protein mRNA, partial cds.756009066 (6)gb:AP005529_18535615e-42Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF031G15Sequence681004412 (6)gb:AP005529_18535616e-83Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070767009066 (6)gb:AP005529_18535612e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070
JMSF045A14Sequence467005230 (2)gb:AP005529_18535619e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070651009066 (6)gb:ATAC010797_15431689e-30Arabidopsis thaliana chromosome III BAC F28J7 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF031G15+ GCAATGGGTTGGCCCGGGGCAATGTATGTTGGCACTCTTTTGGTTGGGGTCGGT
rJMSF011F20+ GCAATGGGTTGGCCCGGGGCAATGTATGTTGGCACTCTTTTGGTTGGGGTCGGT
rJMSF028L08+ GGCCCGGGGCAATGTATGTTGGCACTCTTTTGGTTGGGGTCGGT
rJMFF015N06+ TGGTTGGGGTCGGT
rJMFF018H09+ TCTTTGCAATGGGTTGGCCCGGGGCAATGTATGTTGGCACTCTTTTGGTTGGGGTCGGT
                      ____________________________________________________________
consensus TCTTTGCAATGGGTTGGCCCGGGGCAATGTATGTTGGCACTCTTTTGGTTGGGGTCGGT
 
. : . : . : . : . : . :
rJMSF031G15+ TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCCTCCGAATTGTTTGGATTAAGAAAC
rJMSF011F20+ TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCCTCCGAATTGTTTGGATTAAGAAAC
rJMSF028L08+ TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCCTCCGAATTGTTTGGATTAAGAAAC
rJMFF015N06+ TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCNTCCGAATTGTTTGGATTAAGAAAC
rJMFF018H09+ TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCCTCCGAATTGTTTGGATTAAGAAAC
                      ____________________________________________________________
consensus TATGGAGCTCATTGGGCAATCGTGCCTGCTGCTGCCTCCGAATTGTTTGGATTAAGAAAC
 
. : . : . : . : . : . :
rJMSF031G15+ TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
rJMSF011F20+ TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
rJMSF028L08+ TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
rJMSF045A14+ GTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
rJMFF015N06+ TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
rJMFF018H09+ TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
                      ____________________________________________________________
consensus TTCGGTGCCTTGTACAATTTCCTCACTCTAGCCAACCCCGCAGGCTCATTAGTCTTCTCA
 
. : . : . : . : . : . :
rJMSF031G15+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
rJMSF011F20+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
rJMSF028L08+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
rJMSF045A14+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
rJMFF015N06+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
rJMFF018H09+ GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
                      ____________________________________________________________
consensus GGTCTCATTGCTAGCAGTATATACGACAGAGAAGCCGAAAAGCAGGCCCAAGCAACTCCT
 
. : . : . : . : . : . :
rJMSF031G15+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
rJMSF011F20+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
rJMSF028L08+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
rJMSF045A14+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
rJMFF015N06+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
rJMFF018H09+ CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
                      ____________________________________________________________
consensus CACAACACCCAAACAAATTTGGGATCGGTCCTGTCAACTCTTCTCACTGCTGATGAAACG
 
. : . : . : . : . : . :
rJMSF031G15+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
rJMSF011F20+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
rJMSF028L08+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
rJMSF045A14+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
rJMFF015N06+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
rJMFF018H09+ CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
                      ____________________________________________________________
consensus CTCAAGTGCACTGGCTCTATTTGCTACTTCTTGACTTCCCTCTTAATGTGTGGCCTCTGC
 
. : . : . : . : . : . :
rJMSF031G15+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
rJMSF011F20+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
rJMSF028L08+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
rJMSF045A14+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
rJMFF015N06+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
rJMFF018H09+ ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
                      ____________________________________________________________
consensus ATCGTTGCAGCTATTCTCAGCATGCTTCTTGTATACCGAACAAAGTCTGTCTACTCTCAG
 
. : . : . : . : . : . :
rJMSF031G15+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
rJMSF011F20+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
rJMSF028L08+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
rJMSF045A14+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
rJMFF015N06+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
rJMFF018H09+ CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
                      ____________________________________________________________
consensus CTCTATGGAAAATCCCGCACATAACTCATCCTTCCAGGTGATGAAGAAGCGGTGTTTTTG
 
. : . : . : . : . : . :
rJMSF031G15+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
rJMSF011F20+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
rJMSF028L08+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
rJMSF045A14+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
rJMFF015N06+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
rJMFF018H09+ TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
                      ____________________________________________________________
consensus TGCTTCTTGCAAGATTCAAGATTCTTCTTACTAGACCTTTAAAATCATCACGTGGAGTTC
 
. : . : . : . : . : . :
rJMSF031G15+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
rJMSF011F20+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
rJMSF028L08+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
rJMSF045A14+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
rJMFF015N06+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
rJMFF018H09+ ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
                      ____________________________________________________________
consensus ACGAGAAAGAGCATCAGCTTAATACCACTCCGGGAGATGACACGATTGCATTTTTGCTGC
 
. : . : . : . : . : . :
rJMSF031G15+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
rJMSF011F20+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
rJMSF028L08+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
rJMSF045A14+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
rJMFF015N06+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
rJMFF018H09+ TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
                      ____________________________________________________________
consensus TGGAGGCTCTCTTAAAGGTTTGAGTGCAAGAGCTTTGTTAGTTGGTGTGTGTTCTTTTAT
 
. : . : . : . : . : . :
rJMSF031G15+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
rJMSF011F20+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
rJMSF028L08+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
rJMSF045A14+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
rJMFF015N06+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
rJMFF018H09+ ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
                      ____________________________________________________________
consensus ATAGTGTTCTTTGTGCTGTGAGGTCAAGTCTGAAATTGTTGAGTGAAATATGTGGTTCAG
 
. : . : . : . : . : . :
rJMSF031G15+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGT
rJMSF011F20+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGT
rJMSF028L08+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACAT
rJMSF045A14+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGT
rJMFF015N06+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGT
rJMFF018H09+ TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGTTGTACCA
                      ____________________________________________________________
consensus TTGCAGTTGTATTGCACTAGTTTTTTGTTTGCTTCTCAATGACATTAAAATGTTGTACCA