Previous Contig 009059:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018F13Sequence478009059 (4)pir|D84671|D846713e-25hypothetical protein At2g27310 [imported] - Arabidopsis thaliana>gb:AC006233_153671009059 (4)pir|D84671|D846713e-27hypothetical protein At2g27310 [imported] - Arabidopsis thaliana>gb:AC006233_153
JMSF052I02Sequence644009059 (4)pir|D84671|D846718e-41hypothetical protein At2g27310 [imported] - Arabidopsis thaliana>gb:AC006233_153832009059 (4)pir|D84671|D846713e-45hypothetical protein At2g27310 [imported] - Arabidopsis thaliana>gb:AC006233_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052I02- GAG
                      ____________________________________________________________
consensus GAG
 
. : . : . : . : . : . :
JMFF018F13- GATAACATAATTCCAATGTCTTGTTCCAACACCACAATACCCGCCGCCGATCACGGC
JMSF052I02- ACAGATAACATAATTCCAATTTCTTGTTCCAACACCACAATACCCGCCGCCGATCACGGC
                      ____________________________________________________________
consensus ACAGATAACATAATTCCAATTTCTTGTTCCAACACCACAATACCCGCCGCCGATCACGGC
 
. : . : . : . : . : . :
JMFF018F13- GGAGCGACGGCGATCACCGCCGTCCATCCCGAGATTATTCAAACCCATATATTGAAAAGA
JMSF052I02- GGAGCGACGGCGATCACCGCCGTCCATCCCGAGATTATTCAAACCCATATATTGAAAAGA
                      ____________________________________________________________
consensus GGAGCGACGGCGATCACCGCCGTCCATCCCGAGATTATTCAAACCCATATATTGAAAAGA
 
. : . : . : . : . : . :
JMFF018F13- TTGGACGGCGCAACGCTTGCCTCCGCCGGCTCCGCCTTTTCGCAGCTACGCGCGCTTTGT
JMSF052I02- TTGGACGGCGCAACGCTTGCCTCCGCCGGCTCCGCCTTTTCGCAGCTACGCGCGCTTTGT
                      ____________________________________________________________
consensus TTGGACGGCGCAACGCTTGCCTCCGCCGGCTCCGCCTTTTCGCAGCTACGCGCGCTTTGT
 
. : . : . : . : . : . :
JMFF018F13- TCGGAGGAGAATCTCTGGCGGGATATTTGCAACTCCACTTGGCCGTCAACCACCGACCCA
JMSF052I02- TCGGAGGAGAATCTCTGGCGGGATATTTGCAACTCCACTTGGCCGTCAACCACCGACCCA
                      ____________________________________________________________
consensus TCGGAGGAGAATCTCTGGCGGGATATTTGCAACTCCACTTGGCCGTCAACCACCGACCCA
 
. : . : . : . : . : . :
JMFF018F13- ATCCTCCGCCACGTCATCTCCGCCTTCCCGTCCGGCCACCGGTCGTTCTTTTCCGACGCT
JMSF052I02- ATCCTCCGCCACGTCATCTCCGCCTTCCCGTCCGGCCACCGGTCGTTCTTTTCCGACGCT
rJMSF052I02+ CGCT
                      ____________________________________________________________
consensus ATCCTCCGCCACGTCATCTCCGCCTTCCCGTCCGGCCACCGGTCGTTCTTTTCCGACGCT
 
. : . : . : . : . : . :
JMFF018F13- TTCCCCACCATTCATCATCACCGCCCCCGCCAGGGACCTCAGGAGGAGCACCACCACCAC
JMSF052I02- TTCCCCACCATTCATCATCACCGCCCCCGCCAGGGACCTCAGGAGGAGCACCACCACCAC
rJMSF052I02+ TTCCCCACCATTCATCATCACCGCCCCCGCCAGGGACCTCAGGAGGAGCACCACCACCAC
                      ____________________________________________________________
consensus TTCCCCACCATTCATCATCACCGCCCCCGCCAGGGACCTCAGGAGGAGCACCACCACCAC
 
. : . : . : . : . : . :
JMFF018F13- CACCGCCGCCGCCCGTCTCCGTCGCCGGAGCTCATCTCCGCCGTCGATATCCTCTACGGC
JMSF052I02- CACCGCCGCCGCCCGTCTCCGTCGCCGGAGCTCATCTCCGCCGTCGATATCCTCTACGGC
rJMSF052I02+ CACCGCCGCCGCCCGTCTCCGTCGCCGGAGCTCATCTCCGCCGTCGATATCCTCTACGGC
                      ____________________________________________________________
consensus CACCGCCGCCGCCCGTCTCCGTCGCCGGAGCTCATCTCCGCCGTCGATATCCTCTACGGC
 
. : . : . : . : . : . :
JMFF018F13- GAGAAACTGATATACTCTAAGGTCATTGTCTCCGAAACCGCGTCCGGCTGGTTCCTGTCC
JMSF052I02- GAGAAACTGATATACTCTAAGGTCATTGTCTCCGAAACCGCGTCCGGCTGGTTCCTGTCC
rJMSF052I02+ GAGAAACTGATATACTCTAAGGTCATTGTCTCCGAAACCGCGTCCGGCTGGTTCCTGTCC
                      ____________________________________________________________
consensus GAGAAACTGATATACTCTAAGGTCATTGTCTCCGAAACCGCGTCCGGCTGGTTCCTGTCC
 
. : . : . : . : . : . :
JMFF018F13- T
JMSF052I02- TCCCCGTTCAGAATCGACCTTCTCAGCATGAAAGAGACGGTGCCGACGCCGGTGAAGTTC
rJMSF052I02+ TCCCCGTTCAGAATCGACCTTCTCAGCATGAAAGAGACGGTGCCGACGCCGGTGAAGTTC
                      ____________________________________________________________
consensus TCCCCGTTCAGAATCGACCTTCTCAGCATGAAAGAGACGGTGCCGACGCCGGTGAAGTTC
 
. : . : . : . : . : . :
JMSF052I02- GACGGCGACGAGGCCACGACGGTGGCCCACCTGGAGGAACACCTCCGGCTGAGCTGGATC
rJMSF052I02+ GACGGCGACGAGGCCACGACGGTGGCCCACCTGGAGGAACACCTCCGGCTGAGCTGGATC
rJMFF018F13+ TGAGCTGGATC
                      ____________________________________________________________
consensus GACGGCGACGAGGCCACGACGGTGGCCCACCTGGAGGAACACCTCCGGCTGAGCTGGATC
 
. : . : . : . : . : . :
JMSF052I02- CTGATAGACCCGTCGGCAAAACGCGCCGTGAACATATCAAG
rJMSF052I02+ CTGATAGACCCGTCGGCAAAACGCGCCGTGAACATATCAAGCCTGAAGCCGGTAAACATC
rJMFF018F13+ CTGATAGACCCGTCGGCAAAACGCGCCGTGAACATATCAAGCCTGAAGCCGGTAAACATC
                      ____________________________________________________________
consensus CTGATAGACCCGTCGGCAAAACGCGCCGTGAACATATCAAGCCTGAAGCCGGTAAACATC
 
. : . : . : . : . : . :
rJMSF052I02+ CGACGGCACTGGCTCACCGGAGACATAAAGATACGATTCGGCACGGTGGTTGACGGCGGC
rJMFF018F13+ CGACGGCACTGGCTCACCGGAGACATAAAGATACGATTCGGCACGGTGGTTGACGGCGGC
                      ____________________________________________________________
consensus CGACGGCACTGGCTCACCGGAGACATAAAGATACGATTCGGCACGGTGGTTGACGGCGGC
 
. : . : . : . : . : . :
rJMSF052I02+ GGAATTAGCGACGAAGAGGTGGTGCAGTGCAGCGTGGTGGCCATGTGCGAGGGGAAGGAA
rJMFF018F13+ GGAATTAGCGACGAAGAGGTGGTGCAGTGCAGCGTGGTGGCCATGTGCGAGGGGAAGGAA
                      ____________________________________________________________
consensus GGAATTAGCGACGAAGAGGTGGTGCAGTGCAGCGTGGTGGCCATGTGCGAGGGGAAGGAA
 
. : . : . : . : . : . :
rJMSF052I02+ GGAGGGGAGCTCCACGTGCGGGAGGTGAGCATGCAGGTGGAAGACGTGGACGGGAAAACC
rJMFF018F13+ GGAGGGGAGCTCCACGTGCGGGAGGTGAGCATGCAGGTGGAAGACGTGGACGGGAAAACC
                      ____________________________________________________________
consensus GGAGGGGAGCTCCACGTGCGGGAGGTGAGCATGCAGGTGGAAGACGTGGACGGGAAAACC
 
. : . : . : . : . : . :
rJMSF052I02+ ATGAACGGGAAGGACAGCATGGTAATTTTACAAGACGCCATGGAAAGAAAGAGGAAGAAA
rJMFF018F13+ ATGAACGGGAAGGACAGCATGGTAATTTTACAAGACGCCATGGAAAGAAAGAGGAAGAAA
                      ____________________________________________________________
consensus ATGAACGGGAAGGACAGCATGGTAATTTTACAAGACGCCATGGAAAGAAAGAGGAAGAAA
 
. : . : . : . : . : . :
rJMSF052I02+ AGGGAAGAAGGAGAAGCGAAAGAAGGGTACAAGAAATTCGTGGAATACAAGAAACAATGG
rJMFF018F13+ AGGGAAGAAGGAGAAGCGAAAGAAGGGTACAAGAAATTCGTGGAATACAAGAAACAATGG
                      ____________________________________________________________
consensus AGGGAAGAAGGAGAAGCGAAAGAAGGGTACAAGAAATTCGTGGAATACAAGAAACAATGG
 
. : . : . : . : . : . :
rJMSF052I02+ AGGGAGATAAAACAGAGAAGAGAGAATAGATTGGATATGGCGTGCATAGCTGGTGGAATT
rJMFF018F13+ AGGGAGATAAAACAGAGAAGAGAGAATAGATTGGATATGGCGTGCATAGCTGGTGGAATT
                      ____________________________________________________________
consensus AGGGAGATAAAACAGAGAAGAGAGAATAGATTGGATATGGCGTGCATAGCTGGTGGAATT
 
. : . : . : . : . : . :
rJMSF052I02+ ACCATTTTGATGGCTTTTTTTACCCTGGTTTTGCTGGGTTCAGAAAGGGGTAGAATTTAC
rJMFF018F13+ ACCATTTTGATGGCTTTTTTTACCCTGGTTTTGCTGGGTTCAGAAAGGGGTAGAATTTAC
                      ____________________________________________________________
consensus ACCATTTTGATGGCTTTTTTTACCCTGGTTTTGCTGGGTTCAGAAAGGGGTAGAATTTAC
 
. : . : . : . : . : . :
rJMSF052I02+ TTTTCACATTTATTTTAGTCACATCCCATTGAGACAGGCCACAATCCC
rJMFF018F13+ TTTTCACATTTATTTTAGTCACATCCCATTGAGACAGGCCACAATCCCATGCTACCGAAG
                      ____________________________________________________________
consensus TTTTCACATTTATTTTAGTCACATCCCATTGAGACAGGCCACAATCCCATGCTACCGAAG
 
. : . : . : . : . : . :
rJMFF018F13+ TTGAAACTTTAGTCTCCTATTTTAAATACTGCCTACTAAATCAGAAGCTGGTTACGCAGC
                      ____________________________________________________________
consensus TTGAAACTTTAGTCTCCTATTTTAAATACTGCCTACTAAATCAGAAGCTGGTTACGCAGC
 
. : . : . : . : . : . :
rJMFF018F13+ ACATCCCATTTATTCATTTTATATATAGTTGGTTGGTTTATGATGAAAAATACACAATAC
                      ____________________________________________________________
consensus ACATCCCATTTATTCATTTTATATATAGTTGGTTGGTTTATGATGAAAAATACACAATAC