Previous Contig 009058:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018F10Sequence588004466 (2)pir|G86181|G861817e-70hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889505 Arabid809009058 (2)pir|G86181|G861813e-65hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889505 Arabid
JMSF003A05Sequence277004466 (2)pir|G86181|G861814e-21hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889505 Arabid770009058 (2)pir|G86181|G861811e-58hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889505 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003A05+ TGAAAGAAAACGTTTGATAGCCCTTGCGTAAGGCAGAGA
                      ____________________________________________________________
consensus TGAAAGAAAACGTTTGATAGCCCTTGCGTAAGGCAGAGA
 
. : . : . : . : . : . :
rJMSF003A05+ AAGAGGAAGAGAGAAGAGCAAGGGAAAAAATTCGTCAAAAGTTAGAAGAGGATAAGGCAG
rJMFF018F10+ TCGTCAAAAGTTAGAAGAGGATAAGGCAG
                      ____________________________________________________________
consensus AAGAGGAAGAGAGAAGAGCAAGGGAAAAAATTCGTCAAAAGTTAGAAGAGGATAAGGCAG
 
. : . : . : . : . : . :
rJMSF003A05+ AAAGACGACGCAAACTTGGTTTGCCTCCTGAAGATCCTGCTCCAAAACCTTCTGAACCAG
rJMFF018F10+ AAAGACGACGCAAACTTGGTTTGCNTCCTGAAGATCNTGCTCCAAAACCTTCTGAACCAG
                      ____________________________________________________________
consensus AAAGACGACGCAAACTTGGTTTGCCTCCTGAAGATCCTGCTCCAAAACCTTCTGAACCAG
 
. : . : . : . : . : . :
rJMSF003A05+ TAGTAGAGGAAAAGAAGAGCTCACTGCCTGTCAGACCAGCTACAAAGGCAGAGCAAATGA
rJMFF018F10+ TAGTAGAGGAAAAGAAGAGCTCACTGCCTGTCAGACCAGCTACAAAGGCAGAGCAAATGA
                      ____________________________________________________________
consensus TAGTAGAGGAAAAGAAGAGCTCACTGCCTGTCAGACCAGCTACAAAGGCAGAGCAAATGA
 
. : . : . : . : . : . :
rJMSF003A05+ GGGAGTGCCTGCGTACACTTAAGCAGAGCCACAAGGATGACGAGGCTAAAGTGAAGACTG
rJMFF018F10+ GGGAGTGCCTGCGTACACTTAAGCAGAGCCACAAGGATGACGAGGCTAAAGTGAAGACTG
                      ____________________________________________________________
consensus GGGAGTGCCTGCGTACACTTAAGCAGAGCCACAAGGATGACGAGGCTAAAGTGAAGACTG
 
. : . : . : . : . : . :
rJMSF003A05+ CATTTAATACACTACTAACTTTNGCAAAGAATGTNGCAACAAATCCAAATGAGGAGAAGT
rJMFF018F10+ CATTTAATACACTACTAACTTTTGCAAAGAATGTTGCAACAAATCCAAATGAGGAGAAGT
                      ____________________________________________________________
consensus CATTTAATACACTACTAACTTTTGCAAAGAATGTTGCAACAAATCCAAATGAGGAGAAGT
 
. : . : . : . : . : . :
rJMSF003A05+ TCCGGAAAATTAGACTCAGTAATCCTGCAATCCAGGAAAGAGTTGGAAAATTGAAGGGGG
rJMFF018F10+ TCCGGAAAATTAGACTCAGTAATCCTGCAATCCAGGAAAGAGTTGGAAAATTGAAGGGGG
                      ____________________________________________________________
consensus TCCGGAAAATTAGACTCAGTAATCCTGCAATCCAGGAAAGAGTTGGAAAATTGAAGGGGG
 
. : . : . : . : . : . :
rJMSF003A05+ GTGTGGAGTTCCTTGAGCTTCTTGGATTTGAGAAAATTGAAGGTGGAGAGTTCTTGTATC
rJMFF018F10+ GTGTGGAGTTCCTTGAGCTTCTTGGATTTGAGAAAATTGAAGGTGGAGAGTTCTTGTATC
                      ____________________________________________________________
consensus GTGTGGAGTTCCTTGAGCTTCTTGGATTTGAGAAAATTGAAGGTGGAGAGTTCTTGTATC
 
. : . : . : . : . : . :
rJMSF003A05+ TTCCAAGTGATAAAGTAGACATGGCTGTGCTTCACTCTGCTGGGACCGAGTTGAACAGTG
rJMFF018F10+ TTCCAAGTGATAAAGTAGACATGGCTGTGCTTCACTCTGCTGGGACCGAGTTGAACAGTG
                      ____________________________________________________________
consensus TTCCAAGTGATAAAGTAGACATGGCTGTGCTTCACTCTGCTGGGACCGAGTTGAACAGTG
 
. : . : . : . : . : . :
rJMSF003A05+ CCATCAATAACCCCTTCTTTGGAGTCCTTTGATCCTTACATTAGCTCTGCTGAAACATTN
rJMFF018F10+ CCATCAATAACCCCTTCTTTGGAGTCCTTTGATCCTTACATTAGCTCTGCTGAAACATTC
                      ____________________________________________________________
consensus CCATCAATAACCCCTTCTTTGGAGTCCTTTGATCCTTACATTAGCTCTGCTGAAACATTC
 
. : . : . : . : . : . :
rJMSF003A05+ TAAACTTTGTCAAACCTAATATACAGGAATATGTCGAGTTTTCTCTTGGTTTTGAAAAGG
rJMFF018F10+ TAAACTTTGTCAAACCTAATATACAGGAATATGTCGAGTTTTCTCTTGGTTTTGAAAAGG
                      ____________________________________________________________
consensus TAAACTTTGTCAAACCTAATATACAGGAATATGTCGAGTTTTCTCTTGGTTTTGAAAAGG
 
. : . : . : . : . : . :
rJMSF003A05+ TACATNGGAGGTGGGAAGGGAAAGGAAGGGATATGTTCNGGATAATTGGATTTCATTTTG
rJMFF018F10+ TACATTGGAGGTGGGAAGGGAAAGGAAGGGATATGTTCTGGATAATTGGATTTCATTTTG
                      ____________________________________________________________
consensus TACATTGGAGGTGGGAAGGGAAAGGAAGGGATATGTTCTGGATAATTGGATTTCATTTTG
 
. : . : . : . : . : . :
rJMSF003A05+ CCGTTAGACTATGTTTGGAAACANTTATAGTTTTTCTTTATCATATTTGGTTTTAGAATT
rJMFF018F10+ CCGTTAGACTATGTTTGGAAACAATTATAGTTTTTCTTTATCATATTTAGTTTTAGAATT
                      ____________________________________________________________
consensus CCGTTAGACTATGTTTGGAAACAATTATAGTTTTTCTTTATCATATTTGGTTTTAGAATT
 
. : . : . : . : . : . :
rJMSF003A05+ ATGCCCCCAAA
rJMFF018F10+ ATGCCCCCAAAGGATCATTCTCCAATTGAGAGTGTGGATATATTTGAGGAAGTATTTTGG
                      ____________________________________________________________
consensus ATGCCCCCAAAGGATCATTCTCCAATTGAGAGTGTGGATATATTTGAGGAAGTATTTTGG
 
. : . : . : . : . : . :
rJMFF018F10+ GTAATGTTTTTTTATTTGTTTCAACATTTTAACTGTATTGGAGAACCAAGTTAAATTCAG
                      ____________________________________________________________
consensus GTAATGTTTTTTTATTTGTTTCAACATTTTAACTGTATTGGAGAACCAAGTTAAATTCAG