Previous Contig 009055:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018E18Sequence572000934 (2)gb:AB084464_15243427e-56Pyrus communis PC-EG2 mRNA for endo-1,4-beta-D-glucanase, complete cds.775009055 (2)gb:AF098292_17679122e-32Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.
JMFF035I23Sequence426000934 (2)gb:AF362949_17915101e-26Nicotiana tabacum endo-beta-1,4-glucanase precursor (Cel8) mRNA, complete cds.689009055 (2)gb:AF098292_17679121e-27Lycopersicon esculentum endo-beta-1,4-D-glucanase (Cel8) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF018E18+ CCCAGATGGAGACCAACTCCAACTCCAGCTCCAGCATCAGCTCAAATTTGGGTTC
                      ____________________________________________________________
consensus CCCAGATGGAGACCAACTCCAACTCCAGCTCCAGCATCAGCTCAAATTTGGGTTC
 
. : . : . : . : . : . :
rJMFF035I23+ AGGCAAACTATACCACAGATACTTGGTAA
rJMFF018E18+ AACAGAGGGTGACAAAGTCATGGGTTTATGGAGGCAAACTATACCACAGATACTTGGTAA
                      ____________________________________________________________
consensus AACAGAGGGTGACAAAGTCATGGGTTTATGGAGGCAAACTATACCACAGATACTTGGTAA
 
. : . : . : . : . : . :
rJMFF035I23+ GGGTGACCAACAAATCTGGAAAGACTGTCAAGAATTTGAAGCTCTCCATTTCCAAGCTCT
rJMFF018E18+ GGGTGACCAACAAATCTGGAAAGACTGTCAAGAATTTGAAGCTCTCCATTTCCAAGCTCT
                      ____________________________________________________________
consensus GGGTGACCAACAAATCTGGAAAGACTGTCAAGAATTTGAAGCTCTCCATTTCCAAGCTCT
 
. : . : . : . : . : . :
rJMFF035I23+ ATGGCCCTCTCTGGGGTCTTTCAAAGTATGGGAACTCCTACTTCTTCCCATCATGGCTCA
rJMFF018E18+ ATGGCCCTCTCTGGGGTCTTTCAAAGTATGGGAACTCCTACTTCTTCCCATCATGGCTCA
                      ____________________________________________________________
consensus ATGGCCCTCTCTGGGGTCTTTCAAAGTATGGGAACTCCTACTTCTTCCCATCATGGCTCA
 
. : . : . : . : . : . :
rJMFF035I23+ CCGCTCTACCGGCTGGAAAAACGCTCAAATTCTTGTACATCCACAGCGCCTCCCCGGCTC
rJMFF018E18+ CCGCTCTACCGGCTGGAAAAACGCTCAAATTCTTGTACATCCACAGCGCCTCCCCGGCTC
                      ____________________________________________________________
consensus CCGCTCTACCGGCTGGAAAAACGCTCAAATTCTTGTACATCCACAGCGCCTCCCCGGCTC
 
. : . : . : . : . : . :
rJMFF035I23+ AGGTCTGGGTATCAGGCTACAACCTGCTCTGAAGAATCCCCAGAAACGAGAAGAAACAGA
rJMFF018E18+ AGGTCTGGGTATCAGGCTACAACCTGCTCTGAAGAATCCCCAGAAACGAGAAGAAACAGA
                      ____________________________________________________________
consensus AGGTCTGGGTATCAGGCTACAACCTGCTCTGAAGAATCCCCAGAAACGAGAAGAAACAGA
 
. : . : . : . : . : . :
rJMFF035I23+ AGTTCCAAAAGTGGAATTAATGTAAGAATTGTGCAGCCATATACATTGACGCAGTCGAGG
rJMFF018E18+ AGTTCCAAAAGTGGAATTAATGTAAGAATTGTGCAGCCATATACATTGACGCAGTCGAGG
                      ____________________________________________________________
consensus AGTTCCAAAAGTGGAATTAATGTAAGAATTGTGCAGCCATATACATTGACGCAGTCGAGG
 
. : . : . : . : . : . :
rJMFF035I23+ ATGCCCTTTTTCTTCTTCCAGTCTGTTGTTTACTGTCTGCTGTATTTTTATAATTTTAAA
rJMFF018E18+ ATGCCCTTTTTCTTCTTCCAGTCTGTTGTTTACTGTCTGCTGTATTTTTATAATTTTAAA
                      ____________________________________________________________
consensus ATGCCCTTTTTCTTCTTCCAGTCTGTTGTTTACTGTCTGCTGTATTTTTATAATTTTAAA
 
. : . : . : . : . : . :
rJMFF035I23+ GTTGTGGGTGGTGGGTGGTTTGCAGTTAGGTAAAGATTTGAGTGAAAGACAAGAATGGGG
rJMFF018E18+ GTTGTGGGTGGTGGGTGGTTTGCAGTTAGGTAAAGATTTGAGTGAAAGACAAGAATGGGG
                      ____________________________________________________________
consensus GTTGTGGGTGGTGGGTGGTTTGCAGTTAGGTAAAGATTTGAGTGAAAGACAAGAATGGGG
 
. : . : . : . : . : . :
rJMFF035I23+ AAGAAAGGAGTGAAGAGAGGAATTTAAAATGAGTGCTCATCCTCTTTCTTCTCCACTTTG
rJMFF018E18+ AAGAAAGGAGTGAAGAGAGGAATTTAAAATGAGTGCTCATCCTCTTTCTTCTCCACTTTG
                      ____________________________________________________________
consensus AAGAAAGGAGTGAAGAGAGGAATTTAAAATGAGTGCTCATCCTCTTTCTTCTCCACTTTG
 
. : . : . : . : . : . :
rJMFF035I23+ CTACTTTGCTAGTGAGACATATATACTTATCTGAGAGACACAGGGAATGAGTGTTGAGAA
rJMFF018E18+ CTACTTTGCTAGTGAGACATATATACTTATCTGAGAGACACAGGGAATGAGTGTTGAGAA
                      ____________________________________________________________
consensus CTACTTTGCTAGTGAGACATATATACTTATCTGAGAGACACAGGGAATGAGTGTTGAGAA
 
. : . : . : . : . : . :
rJMFF035I23+ GTTTAAGGCAAAAAAGCTGACTTCTCAACCAAAATCTAGTCTTTAATTTGGTTTCATGGT
rJMFF018E18+ GTTTAAGGCAAAAAAGCTGACTTCTCAACCAAAATCTAGTCTTTAATTTGGTTTCATGGT
                      ____________________________________________________________
consensus GTTTAAGGCAAAAAAGCTGACTTCTCAACCAAAATCTAGTCTTTAATTTGGTTTCATGGT
 
. : . : . : . : . : . :
rJMFF035I23+ TCTTTGCCCTTTTGGTGTTGTAATGTTGTAAGCTTTACAACATTTCTGCTATCAATCAAT
rJMFF018E18+ TCTTTGCCCTTTTGGTGTTGTAATGTTGTAAGCTTTACAACATTTCTGCTATCAATCAAT
                      ____________________________________________________________
consensus TCTTTGCCCTTTTGGTGTTGTAATGTTGTAAGCTTTACAACATTTCTGCTATCAATCAAT