Previous Contig 009054:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018E15Sequence522000295 (7)pir|T48328|T483281e-35importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops763009054 (3)pir|T48328|T483288e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF026O14Sequence521000295 (7)pir|T48328|T483286e-36importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops768009054 (3)pir|T48328|T483288e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops
JMFF031H04Sequence603000295 (7)pir|T48328|T483288e-37importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops716009054 (3)pir|T48328|T483287e-68importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026O14+ CNTACGGAGTTTAGGTAATCTTGTGGCTGGTGAAACTCGTATAACTAATG
rJMFF031H04+ AAACTCGTATAACTAATG
rJMFF018E15+ AGTTTAGGTAATCTTGTGGCTGGTGAAACTCGTATAACTAATG
                      ____________________________________________________________
consensus CNTACGGAGTTTAGGTAATCTTGTGGCTGGTGAAACTCGTATAACTAATG
 
. : . : . : . : . : . :
rJMFF026O14+ CTGTTCTTGTCGCTGGAAACGAGATAACAGATGCGTTTATCCAAGCACAGGTGAAGTGTT
rJMFF031H04+ CTGTTCTTGTCGCTGGAAACGAGATAACAGATGCGTTTATCCAAGCACAGGTGAAGTGTT
rJMFF018E15+ CTGTTCTTGTCGCTGGAAACGAGATAACAGATGCGTTTATCCAAGCACAGGTGAAGTGTT
                      ____________________________________________________________
consensus CTGTTCTTGTCGCTGGAAACGAGATAACAGATGCGTTTATCCAAGCACAGGTGAAGTGTT
 
. : . : . : . : . : . :
rJMFF026O14+ TGAAAAGCGAACATCGTATCTTGAAGAAGGAAGCAGCTTGGGTACTATCTAATCTAGCAG
rJMFF031H04+ TGAAAAGCGAACATCGTATCTTGAAGAAGGAAGCAGCTTGGGTACTATCTAATCTAGCAG
rJMFF018E15+ TGAAAAGCGAACATCGTATCTTGAAGAAGGAAGCAGCTTGGGTACTATCTAATCTAGCAG
                      ____________________________________________________________
consensus TGAAAAGCGAACATCGTATCTTGAAGAAGGAAGCAGCTTGGGTACTATCTAATCTAGCAG
 
. : . : . : . : . : . :
rJMFF026O14+ CCGGGTCTGCAGAACATAAGAAATTAATACATTCAAGCGATGCGTTGGCAGTGTTATTGC
rJMFF031H04+ CCGGGTCTGCAGAACATAAGAAATTAATACATTCAAGCGATGCGTTGGCAGTGTTATTGC
rJMFF018E15+ CCGGGTCTGCAGAACATAAGAAATTAATACATTCAAGCGATGCGTTGGCAGTGTTATTGC
                      ____________________________________________________________
consensus CCGGGTCTGCAGAACATAAGAAATTAATACATTCAAGCGATGCGTTGGCAGTGTTATTGC
 
. : . : . : . : . : . :
rJMFF026O14+ ACCTTCTTTCGACAGCACCTTTTGACATAAAAAAGGAGGTAGCATATGTTCTGGGCAACC
rJMFF031H04+ ACCTTCTTTCGACAGCACCTTTTGACATAAAAAAGGAGGTAGCATATGTTCTGGGCAACC
rJMFF018E15+ ACCTTCTTTCGACAGCACCTTTTGACATAAAAAAGGAGGTAGCATATGTTCTGGGCAACC
                      ____________________________________________________________
consensus ACCTTCTTTCGACAGCACCTTTTGACATAAAAAAGGAGGTAGCATATGTTCTGGGCAACC
 
. : . : . : . : . : . :
rJMFF026O14+ TCTGTGTTGCCCCGGATGACGGTTCTGGAATGCCAAAGTTGATACTGGAACACTTGGTTT
rJMFF031H04+ TCTGTGTTGCCCCGGATGACGGTTCTGGAATGCCAAAGTTGATACTGGAACACTTGGTTT
rJMFF018E15+ TCTGTGTTGCCCCGGATGACGGTTCTGGAATGCCAAAGTTGATACTGGAACACTTGGTTT
                      ____________________________________________________________
consensus TCTGTGTTGCCCCGGATGACGGTTCTGGAATGCCAAAGTTGATACTGGAACACTTGGTTT
 
. : . : . : . : . : . :
rJMFF026O14+ CCCTCGTGGGAAGAGGATGCCTTTCCGGATTCGTTGATTTAGTAAGGTCAGTCGACGCTG
rJMFF031H04+ CCCTCGTGGGAAGAGGATGCCTTTCCGGATTCGTTGATTTAGTAAGGTCAGTCGACGCTG
rJMFF018E15+ CCCTCGTGGGAAGAGGATGCCTTTCCGGATTCGTTGATTTAGTAAGGTCAGTCGACGCTG
                      ____________________________________________________________
consensus CCCTCGTGGGAAGAGGATGCCTTTCCGGATTCGTTGATTTAGTAAGGTCAGTCGACGCTG
 
. : . : . : . : . : . :
rJMFF026O14+ AGGCTGCAAGACTCGGGATGCAATTTCTTGAGCTGGTTCTAAGGGGAATGCCAAACCGCG
rJMFF031H04+ AGGCTGCAAGACTCGGGATGCAATTTCTTGAGCTGGTTCTAAGGGGAATGCCAAACCGCG
rJMFF018E15+ AGGCTGCAAGACTCGGGATGCAATTTCTTGAGCTGGTTCTAAGGGGAATGCCAAACCGCG
                      ____________________________________________________________
consensus AGGCTGCAAGACTCGGGATGCAATTTCTTGAGCTGGTTCTAAGGGGAATGCCAAACCGCG
 
. : . : . : . : . : . :
rJMFF026O14+ AGGGCCCAAAGCTGGTGGAGAAGGAGGATGGCATCGAAGCCTTGGAGCGATACCAATTCC
rJMFF031H04+ AGGGCCCAAAGCTGGTGGAGAAGGAGGATGGCATCGAAGCCTTGGAGCGATACCAATTCC
rJMFF018E15+ AGGGCCCAAAGCTGGTGGAGAAGGAGGATGGCATCGAAGCCTTGGAGCGATACCAATTCC
                      ____________________________________________________________
consensus AGGGCCCAAAGCTGGTGGAGAAGGAGGATGGCATCGAAGCCTTGGAGCGATACCAATTCC
 
. : . : . : . : . : . :
rJMFF026O14+ ACGAAAACGAAGAACTGAGGGGCATGGCTAATGAGTTGCTGGACAAGTACTATGGGGATG
rJMFF031H04+ ACGAAAACGAAGAACTGAGGGGCATGGCTAATGAGTTGCTGGACAAGTACTATGGGGATG
rJMFF018E15+ ACGAAAACGAAGAACTGAGGGGCATGGCTAATGAGTTGCTGGACAAGTACTATGGGGATG
                      ____________________________________________________________
consensus ACGAAAACGAAGAACTGAGGGGCATGGCTAATGAGTTGCTGGACAAGTACTATGGGGATG
 
. : . : . : . : . : . :
rJMFF026O14+ AGTATGGACTTGAAGAGTAGAAAGAGCAGTGATGATGTATTCTGCAAATGTTTACTGGAA
rJMFF031H04+ AGTATGGACTTGAAGAGTAGAAAGAGCAGTGATGATGTATTCTGCAAATGTTTACTGGAA
rJMFF018E15+ AGTATGGACTTGAAGAGTAGAAAGAGCAGTGATGATGTATTCTGCAAATGTTTACTGGAA
                      ____________________________________________________________
consensus AGTATGGACTTGAAGAGTAGAAAGAGCAGTGATGATGTATTCTGCAAATGTTTACTGGAA
 
. : . : . : . : . : . :
rJMFF026O14+ TTTTGATGTCTCTCCTCTTGTGTGCCAAAACTCTAGCCCCCTTGAAACCATTCTGCTGTA
rJMFF031H04+ TTTTGATGTCTCTCCTCTTGTGTGCCAAAACTCTAGCCCCCTTGAAACCATTCTGCTGTA
rJMFF018E15+ TTTTGATGTCTCTCCTCTTGTGTGCCAAAACTCTAGCCCCCTTGAAACCATTCTGCTGTA
                      ____________________________________________________________
consensus TTTTGATGTCTCTCCTCTTGTGTGCCAAAACTCTAGCCCCCTTGAAACCATTCTGCTGTA
 
. : . : . : . : . : . :
rJMFF026O14+ CTGCCTTTTGTACAAATATCAAATAGGTGGAGAGTTTTAAATGCCATTGGTTCAAGTC
rJMFF031H04+ CTGCCTTTTGTACAAATATCAAATAGGTGGAGAGTTTT
rJMFF018E15+ CTGCCTTTTGTACAAATATCAAATAGGTGGAGAGTTTTAAATGCCATTGGTTCAAGTCAT
                      ____________________________________________________________
consensus CTGCCTTTTGTACAAATATCAAATAGGTGGAGAGTTTTAAATGCCATTGGTTCAAGTCAT