Previous Contig 009052:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008C10Sequence564006824 (5)gb:OSJN00074_16943597e-58Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06, complete seque778009052 (5)gb:OSJN00074_16943591e-65Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06, complete seque
JMFF008L01Sequence545006824 (5)gb:OSJN00074_16943597e-57Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06, complete seque655009052 (5)gb:OSJN00074_16943596e-55Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06, complete seque
JMFF018D07Sequence570006824 (5)gb:AB073171_15231554e-06Arabidopsis thaliana AtAPG4a mRNA for autophagy 4a, complete cds.500009052 (5)gb:AC099323_17370449e-13Oryza sativa chromosome 3 BAC OSJNBa0065F09 genomic sequence, complete sequence.
JMFF039C07Sequence473006824 (5)691009052 (5)gb:OSJN00074_16943598e-56Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0032F06, complete seque
JMSF032G07Sequence622006824 (5)gb:AB073171_15231558e-06Arabidopsis thaliana AtAPG4a mRNA for autophagy 4a, complete cds.740009052 (5)gb:AB073171_15231552e-57Arabidopsis thaliana AtAPG4a mRNA for autophagy 4a, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF008C10+ CTGGGGATGAAGATGGAGAAAGGGGCGGTGCACCAGCCCTTTGCATTGA
rJMSF032G07+ GCATTGA
                      ____________________________________________________________
consensus CTGGGGATGAAGATGGAGAAAGGGGCGGTGCACCAGCCCTTTGCATTGA
 
. : . : . : . : . : . :
rJMFF039C07+ CTCGAGTTGTCAAAAGGCCAAGTTGATTGGGCTCCTATAAT
rJMFF008C10+ TGATATCTCAAGGCGATGCCTCGAGTTGTCAAAAGGCCAAGTTGATTGGGCTCCTATAAT
rJMSF032G07+ TGATATCTCAAGGCGATGCCTCGAGTTGTCAAAAGGCCAAGTTGGTTGGGCTCCTATAAT
                      ____________________________________________________________
consensus TGATATCTCAAGGCGATGCCTCGAGTTGTCAAAAGGCCAAGTTGATTGGGCTCCTATAAT
 
. : . : . : . : . : . :
rJMFF039C07+ TTTGTTGGTTCCCTTGGTCTTAGGACTCGACAAGGTTAACCCAAGGTATATTCCCTTGTT
rJMFF008L01+ TGGTCTTAGGACTCGACAAGGTTAACCCAAGGTATATTCCCTTGTT
rJMFF008C10+ TTTGTTGGTTCCCTTGGTCTTAGGACTCGACAAGGTTAACCCAAGGTATATTCCCTTGTT
rJMSF032G07+ TTTGTTGGTTCCCTTGGTCTTAGGACTCGACAAGGTTAACCCAAGGTATATTCCCTTGTT
                      ____________________________________________________________
consensus TTTGTTGGTTCCCTTGGTCTTAGGACTCGACAAGGTTAACCCAAGGTATATTCCCTTGTT
 
. : . : . : . : . : . :
rJMFF039C07+ AAAAGCTACATTCAGCTTCCCCCAAAGCCTGGGAATCCTTGGTGGTAGACCTGGAGTCTC
rJMFF008L01+ AAAAGCTACATTCAGCTTCCCCCAAAGCCTGGGAATCCTTGGTGGTAGACCTGGAGTCTC
rJMFF008C10+ AAAAGCTACATTCAGCTTCCCCCAAAGCCTGGGAATCCTTGGTGGTAGACCTGGAGTCTC
rJMSF032G07+ AAAAGCTACATTCAGCTTCCCCCAAAGCCTGGGAATCCTTGGTGGTAGACCTGGAGTCTC
                      ____________________________________________________________
consensus AAAAGCTACATTCAGCTTCCCCCAAAGCCTGGGAATCCTTGGTGGTAGACCTGGAGTCTC
 
. : . : . : . : . : . :
rJMFF039C07+ AACATACATTGTTGGTGTGCAGGATGATCAGGCATTTTATCTTGATCCACATGAAGTTCA
rJMFF008L01+ AACATACATTGTTGGTGTGCAGGATGATCAGGCATTTTATCTTGATCCACATGAAGTTCA
rJMFF008C10+ AACATACATTGTTGGTGTGCAGGATGATCAGGCATTTTATCTTGATCCACATGAAGTTCA
rJMSF032G07+ AACATACATTGTTGGTGTGCAGGATGATCAGGCATTTTATCTTGATCCACATGAAGTTCA
                      ____________________________________________________________
consensus AACATACATTGTTGGTGTGCAGGATGATCAGGCATTTTATCTTGATCCACATGAAGTTCA
 
. : . : . : . : . : . :
rJMFF039C07+ ACAAGTTGTTGATCTTGGGAGGGATAATTTAGATATCGACACTTCATCCTACCACTGCGA
rJMFF008L01+ ACAAGTTGTTGATCTTGGGAGGGATAATTTAGATATCGACACTTCATCCTACCACTGCGA
rJMFF008C10+ ACAAGTTGTTGATCTTGGGAGGGATAATTTAGATATCGACACTTCATCCTACCACTGCGA
rJMSF032G07+ ACAAGTTGTTGATCTTGGGAGGGATAATTTAGATATCGACACTTCATCCTACCACTGCGA
                      ____________________________________________________________
consensus ACAAGTTGTTGATCTTGGGAGGGATAATTTAGATATCGACACTTCATCCTACCACTGCGA
 
. : . : . : . : . : . :
rJMFF039C07+ TGTTGTGCGGCAGCTCCCACTTGATTCCATTGATCCATCCTTGGCTATCGGGTTTTACTG
rJMFF008L01+ TGTTGTGCGGCAGCTCCCACTTGATTCCATTGATCCATCCTTGGCTATCGGGTTTTACTG
rJMFF008C10+ TGTTGTGCGGCAGCTCCCACTTGATTCCATTGATCCATCCTTGGCTATCGGGTTTTACTG
rJMSF032G07+ TGTTGTGCGGCAGCTCCCACTTGATTCCATTGATCCATCCTTGGCTATCGGGTTTTACTG
rJMFF018D07+ TTGGCTATCGGGTTTTACTG
                      ____________________________________________________________
consensus TGTTGTGCGGCAGCTCCCACTTGATTCCATTGATCCATCCTTGGCTATCGGGTTTTACTG
 
. : . : . : . : . : . :
rJMFF039C07+ CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
rJMFF008L01+ CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
rJMFF008C10+ CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
rJMSF032G07+ CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
rJMFF018D07+ CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
                      ____________________________________________________________
consensus CAAAGACAAGAGCGATTTTGATGATTTTTGTGCACGAGCATCGGAGCTGGTTGATCAATC
 
. : . : . : . : . : . :
rJMFF039C07+ AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
rJMFF008L01+ AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
rJMFF008C10+ AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
rJMSF032G07+ AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
rJMFF018D07+ AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
                      ____________________________________________________________
consensus AGGTGGTGCTCCACTGTTCACCATAACCGAGACTCGGAATGTCTCCATGCCAGTCCAATA
 
. : . : . : . : . : . :
rJMFF039C07+ TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
rJMFF008L01+ TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
rJMFF008C10+ TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
rJMSF032G07+ TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
rJMFF018D07+ TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
                      ____________________________________________________________
consensus TCAAGATATGCAGGGCGAGGCGAGTGCAGAAGGATTCAAGTCATTCGATGCAACCTCCAT
 
. : . : . : . : . : . :
rJMFF039C07+ TGGTGATTCGGAGAACGGTAAACAAGAAGAT-GACTGGCAACTTCTTTGAAGCTGGATCT
rJMFF008L01+ TGGTGATTCGGAGAACGGTAAACAAGAAGAT-GACTGGCAACTTCTTTGAAGCTGGATCT
rJMFF008C10+ TGGTGATTCGGAGAACGGTAAACAAGAAGAT-GACTGGCAACTTCTTTGAAGCTGGATCT
rJMSF032G07+ TGGTGATTCGGAGAACGGTAAACAAGAAGAT-GACTGGCAACTTCTTTGAAGCTGGATCT
rJMFF018D07+ TGGTGATTCGGAGAACGGTAAACAAGAAGATGGACTGGCAACTTCTTTGAAGCTGGATCT
                      ____________________________________________________________
consensus TGGTGATTCGGAGAACGGTAAACAAGAAGAT-GACTGGCAACTTCTTTGAAGCTGGATCT
 
. : . : . : . : . : . :
rJMFF039C07+ GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
rJMFF008L01+ GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
rJMFF008C10+ GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
rJMSF032G07+ GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
rJMFF018D07+ GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
                      ____________________________________________________________
consensus GTGTTTGTATTTCCTGCCCTACCCAATTCTCAGGGGAGGGTTGAAAACTGTAAAGATAAA
 
. : . : . : . : . : . :
rJMFF039C07+ CAACACGTATTAGGCTCTGTTATTAGCTTCAG-TTGAAATGTTGTTATTTTT
rJMFF008L01+ CAACACGTATTAGGCTCTGTTATTAGCTTCAGTTTGAAATGTTGTTATTTTTTATTGATA
rJMFF008C10+ CAACACGTATTAGGCTCTGTTATTAGCTTCAGTTTGAAATGTTGTTATTTTTTATTGATA
rJMSF032G07+ CAACACGTATTAGGCTCTGTTATTAGCTTCAGTTTGAAATGTTGTTATTTTTTATTGATA
rJMFF018D07+ CAACACGTATTAGGCTCTGTTATTAGCTTCAGTTTGAAATGTTGTTATTTTTTATTGATA
                      ____________________________________________________________
consensus CAACACGTATTAGGCTCTGTTATTAGCTTCAGTTTGAAATGTTGTTATTTTTTATTGATA
 
. : . : . : . : . : . :
rJMFF008L01+ TTTT
rJMFF008C10+ TTTT
rJMSF032G07+ TTTT
rJMFF018D07+ TTTTTGAAACTTGAATGATATGTGATATTCATTACATTATTTGGGAATAGATTTTATTCT
                      ____________________________________________________________
consensus TTTTTGAAACTTGAATGATATGTGATATTCATTACATTATTTGGGAATAGATTTTATTCT
 
. : . : . : . : . : . :
rJMFF018D07+ TTCTTTTCAATTATTGGGTGGGGATTCGAGTACGTTGAACATTGAGGAATGATAGCTTAA
                      ____________________________________________________________
consensus TTCTTTTCAATTATTGGGTGGGGATTCGAGTACGTTGAACATTGAGGAATGATAGCTTAA