Previous Contig 009048:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018C18Sequence529007309 (3)gb:AF361817_17914091e-30Arabidopsis thaliana At1g06730/F4H5_22 mRNA, complete cds.759009048 (3)gb:AC104428_17376042e-47Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1123F12, complete se
JMSF038B17Sequence722007309 (3)gb:AF361817_17914092e-34Arabidopsis thaliana At1g06730/F4H5_22 mRNA, complete cds.872009048 (3)gb:AF361817_17914095e-60Arabidopsis thaliana At1g06730/F4H5_22 mRNA, complete cds.
JMSF039L03Sequence680007309 (3)gb:AF361817_17914095e-29Arabidopsis thaliana At1g06730/F4H5_22 mRNA, complete cds.867009048 (3)gb:AC104428_17376044e-58Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1123F12, complete se

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF039L03+ TTCAGGAAGACCTGAAGAACAGAGAGCAGCT
rJMSF038B17+ CTGACCCTTGTTCAGGAAGACCTGAAGAACAGAGAGCAGCT
                      ____________________________________________________________
consensus CTGACCCTTGTTCAGGAAGACCTGAAGAACAGAGAGCAGCT
 
. : . : . : . : . : . :
rJMSF039L03+ GACAAATTCTTCCAAGATGAGTGATGTGCTTCTTTTGACTTCTGAAGAGGCAGGATCGTT
rJMSF038B17+ GACAAATTCTT-CAAGATGAGTGATGTGCTTCTTTTGACTTCTGAAGAGGCAGGATCGTT
                      ____________________________________________________________
consensus GACAAATTCTTCCAAGATGAGTGATGTGCTTCTTTTGACTTCTGAAGAGGCAGGATCGTT
 
. : . : . : . : . : . :
rJMSF039L03+ GACTGGCATTGAAAATCCAATTATGGCAGGGCAAGAGTTGCTAAAGAAAGGAGCCCGTCT
rJMSF038B17+ GACTGGCATTGAAAATCCAATTATGGCAGGGCAAGAGTTGCTAAAGAAAGGAGCCCGTCT
rJMFF018C18+ TATGGCAGGGCAAGAGTTGCTAAAGAAAGGAGCCCGTCT
                      ____________________________________________________________
consensus GACTGGCATTGAAAATCCAATTATGGCAGGGCAAGAGTTGCTAAAGAAAGGAGCCCGTCT
 
. : . : . : . : . : . :
rJMSF039L03+ TAAGTGGGTGATTGTTAAGATGGGTGCAAAGGGTTCAATTTTGATCACCAAATCAAGTAT
rJMSF038B17+ TAAGTGGGTGATTGTTAAGATGGGTGCAAAGGGTTCAATTTTGATCACCAAATCAAGTAT
rJMFF018C18+ TAAGTGGGTGATTGTTAAGATGGGTGCAAAGGGTTCAATTTTGATCACCAAATCAAGTAT
                      ____________________________________________________________
consensus TAAGTGGGTGATTGTTAAGATGGGTGCAAAGGGTTCAATTTTGATCACCAAATCAAGTAT
 
. : . : . : . : . : . :
rJMSF039L03+ AACTTGTGCCCCTGGATTCAAGGTGAATGTTATTGACACTGTTGGGTGTGGAGACAGCTT
rJMSF038B17+ AACTTGTGCCCCTGGATTCAAGGTGAATGTTATTGACACTGTTGGGTGTGGAGACAGCTT
rJMFF018C18+ AACTTGTGCCCCTGGATTCAAGGTGAATGTTATTGACACTGTTGGGTGTGGAGACAGCTT
                      ____________________________________________________________
consensus AACTTGTGCCCCTGGATTCAAGGTGAATGTTATTGACACTGTTGGGTGTGGAGACAGCTT
 
. : . : . : . : . : . :
rJMSF039L03+ TGTGGCTGCCGTTGCATTTGGTTTTATACACAATGTGCCATTGGTATATACTCTAACCCT
rJMSF038B17+ TGTGGCTGCCGTTGCATTTGGTTTTATACACAATGTGCCATTGGTATATACTCTAACCCT
rJMFF018C18+ TGTGGCTGCCGTTGCATTTGGTTTTATACACAATGTGCCATTGGTATATACTCTAACCCT
                      ____________________________________________________________
consensus TGTGGCTGCCGTTGCATTTGGTTTTATACACAATGTGCCATTGGTATATACTCTAACCCT
 
. : . : . : . : . : . :
rJMSF039L03+ GGCAAATGCAGTGGGCGGTGCAACTGCTATGGGTTGTGGTGCTGGTAGAAATGTCGCGAC
rJMSF038B17+ GGCAAATGCAGTGGGCGGTGCAACTGCTATGGGTTGTGGTGCTGGTAGAAATGTCGCGAC
rJMFF018C18+ GGCAAATGCAGTGGGCGGTGCAACTGCTATGGGTTGTGGTGCTGGTAGAAATGTCGCGAC
                      ____________________________________________________________
consensus GGCAAATGCAGTGGGCGGTGCAACTGCTATGGGTTGTGGTGCTGGTAGAAATGTCGCGAC
 
. : . : . : . : . : . :
rJMSF039L03+ CCTAGAGCAAGTGAAGGAACTCATGAGAAGATCAGATATTAACGAGGATGAAAAGTTATG
rJMSF038B17+ CCTAGAGCAAGTGAAGGAACTCATGAGAAGATCAGATATTAACGAGGATGAAAAGTTATG
rJMFF018C18+ CCTAGAGCAAGTGAAGGAACTCATGAGAAGATCAGATATTAACGAGGATGAAAAGTTATG
                      ____________________________________________________________
consensus CCTAGAGCAAGTGAAGGAACTCATGAGAAGATCAGATATTAACGAGGATGAAAAGTTATG
 
. : . : . : . : . : . :
rJMSF039L03+ GGAGGAGTTACTTAGTGATAGTGTAGGAACCTTAGAAGTAAATTTACTCTCAAGATCACT
rJMSF038B17+ GGAGGAGTTACTTAGTGATAGTGTAGGAACCTTAGAAGTAAATTTACTCTCAAGATCACT
rJMFF018C18+ GGAGGAGTTACTTAGTGATAGTGTAGGAACCTTAGAAGTAAATTTACTCTCAAGATCACT
                      ____________________________________________________________
consensus GGAGGAGTTACTTAGTGATAGTGTAGGAACCTTAGAAGTAAATTTACTCTCAAGATCACT
 
. : . : . : . : . : . :
rJMSF039L03+ CATAGACCAGAACAGCCAACAGCTTAACGTAGTTCCCCTGCAAAGGGCGGTCTCTGAAAT
rJMSF038B17+ CATAGACCAGAACAGCCAACAGCTTAACGTAGTTCCCCTGCAAAGGGCGGTCTCTGAAAT
rJMFF018C18+ CATAGACCAGAACAGCCAACAGCTTAACGTAGTTCCCCTGCAAAGGGCGGTCTCTGAAAT
                      ____________________________________________________________
consensus CATAGACCAGAACAGCCAACAGCTTAACGTAGTTCCCCTGCAAAGGGCGGTCTCTGAAAT
 
. : . : . : . : . : . :
rJMSF039L03+ TCTACCCAAGCTCTTACCTACTCAGTCAAAGATGGCCATCGTTTCTTCACTGTCATGAAC
rJMSF038B17+ TCTACCCAAGCTCTTACCTACTCAGTCAAAGATGGCCATCGTTTCTTCACTGTCATGAAC
rJMFF018C18+ TCTACCCAAGCTCTTACCTACTCAGTCAAAGATGGCCATCGTTTCTTCACTGTCATGAAC
                      ____________________________________________________________
consensus TCTACCCAAGCTCTTACCTACTCAGTCAAAGATGGCCATCGTTTCTTCACTGTCATGAAC
 
. : . : . : . : . : . :
rJMSF039L03+ AGACGTTATGATGGTAGATTGGTTATATTTGCTATAGTCATCAACATATGATTACTATCG
rJMSF038B17+ AGACGTTATGATGGTAGATTGGTTATATTTGCTATAGTCATCAACATATGATTACTATCG
rJMFF018C18+ AGACGTTATGATGGTAGATTGGTTATATTTGCTATAGTCATCAACATATGATTACTATCG
                      ____________________________________________________________
consensus AGACGTTATGATGGTAGATTGGTTATATTTGCTATAGTCATCAACATATGATTACTATCG
 
. : . : . : . : . : . :
rJMSF039L03+ CCTTACTCCTCACCACAAAAACACAGCTCAAGATTGGAGATGAATGGTAAGTTGAGACAA
rJMSF038B17+ CCTTACTCCTCACCACAAAAACACAGCTCAAGATTGGAGATGAATGGTAAGTTGAGACAA
rJMFF018C18+ CCTTACTCCTCACCACAAAAACACAGCTCAAGATTGGAGATGAATGGTAAGTTGAGACAA
                      ____________________________________________________________
consensus CCTTACTCCTCACCACAAAAACACAGCTCAAGATTGGAGATGAATGGTAAGTTGAGACAA
 
. : . : . : . : . : . :
rJMSF039L03+ TATTTTAGTTTCAGGGAAGGGTGCTCAATATTGTGGGTTGTATTTTTACCATCTTGATGA
rJMSF038B17+ TATTTTAGTTTCAGGGAAGGGTGCTCAATATTGTGGGTTGTATTTTTACCATCTTGATGA
rJMFF018C18+ TATTTTAGTTTCAGGGAAGGGTGCTCAATATTGTGGGTTGTATTTTTACCATCTTGATGA
                      ____________________________________________________________
consensus TATTTTAGTTTCAGGGAAGGGTGCTCAATATTGTGGGTTGTATTTTTACCATCTTGATGA
 
. : . : . : . : . : . :
rJMSF039L03+ TTAAATAAACTTATAGCGCACGATTTACACAATCAATTCTTGTAATTTA
rJMSF038B17+ TTAAATAAACTTATAGCGCACGATTTACACAATCAATTCTTGTAATTTA
rJMFF018C18+ TTAAATAAACTTATAGCGCACGATTTACACAATCAATTCTTGTAATTTACTTGGCACAGC
                      ____________________________________________________________
consensus TTAAATAAACTTATAGCGCACGATTTACACAATCAATTCTTGTAATTTACTTGGCACAGC