Previous Contig 009043:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF018A12Sequence776009043 (8)sp|P55857|SMT3_ORYSA2e-29Ubiquitin-like protein SMT3.>pir|T04102|T04102 smt3 protein - rice>gb:AB016030_1925009043 (8)gb:AF451278_18008199e-20Phaseolus vulgaris ubiquitin-like protein SMT3 (SMT3) mRNA, partial cds.
JMFF044A19Sequence637009043 (8)sp|P55857|SMT3_ORYSA1e-29Ubiquitin-like protein SMT3.>pir|T04102|T04102 smt3 protein - rice>gb:AB016030_1620009043 (8)gb:AF451278_18008192e-17Phaseolus vulgaris ubiquitin-like protein SMT3 (SMT3) mRNA, partial cds.
JMFS056E04Sequence634009043 (8)sp|P55857|SMT3_ORYSA9e-29Ubiquitin-like protein SMT3.>pir|T04102|T04102 smt3 protein - rice>gb:AB016030_1
JMFS088C12Sequence634009043 (8)sp|P55857|SMT3_ORYSA3e-30Ubiquitin-like protein SMT3.>pir|T04102|T04102 smt3 protein - rice>gb:AB016030_1
JMSF008A09Sequence191009043 (8)sp|P55857|SMT3_ORYSA1e-08Ubiquitin-like protein SMT3.>pir|T04102|T04102 smt3 protein - rice>gb:AB016030_1829009043 (8)gb:AF451278_18008193e-21Phaseolus vulgaris ubiquitin-like protein SMT3 (SMT3) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044A19- GTCTGCTCACACTTTGCATTTGCAGTATATATAATCATACAAAAGAG
rJMSF008A09- AAAAGAG
rJMFF018A12- TTGCAGTATATATAATCATACAAAAGAG
                      ____________________________________________________________
consensus GTCTGCTCACACTTTGCATTTGCAGTATATATAATCATACAAAAGAG
 
. : . : . : . : . : . :
rJMFF044A19- TTCATTCAAAAGCAATTTCAACCCGCTGAGAGGGGACAGCTTACAGTCTACACTGGCAGT
rJMSF008A09- TTCATTCAAAAGCAATTTCAACCCGCTGAGAGGGGACAGCTTACAGTCTACACTGGCAGT
rJMFF018A12- TTCATTCAAAAGCAATTTCAACCCGCTGAGAGGGGACAGCTTACAGTCTACACTGGCAGT
                      ____________________________________________________________
consensus TTCATTCAAAAGCAATTTCAACCCGCTGAGAGGGGACAGCTTACAGTCTACACTGGCAGT
 
. : . : . : . : . : . :
rJMFF044A19- GAACAACTATCAGTAATACAGAAGAAGGTGAGTCTCATGGTTTTAGACAGCATTTCATAC
rJMSF008A09- GAACAACTATCAGTAATACAGAAGAAGGTGAGTCTCATGGTTTTAGACAGCATTTCATAC
rJMFF018A12- GAACAACTATCAGTAATACAGAAGAAGGTGAGTCTCATGGTTTTAGACAGCATTTCATAC
                      ____________________________________________________________
consensus GAACAACTATCAGTAATACAGAAGAAGGTGAGTCTCATGGTTTTAGACAGCATTTCATAC
 
. : . : . : . : . : . :
rJMFF044A19- CTGCTCTCTTGTAACATATGTAAATGATGTAAATAGTCATCTTCTCAGTGGATAAATGCA
rJMSF008A09- CTGCTCTCTTGTAACATATGTAAATGATGTAAATAGTCATCTTCTCAGTGGATAAATGCA
rJMFF018A12- CTGCTCTCTTGTAACATATGTAAATGATGTAAATAGTCATCTTCTCAGTGGATAAATGCA
                      ____________________________________________________________
consensus CTGCTCTCTTGTAACATATGTAAATGATGTAAATAGTCATCTTCTCAGTGGATAAATGCA
 
. : . : . : . : . : . :
rJMFF044A19- TATATTCCTTTCCATTCTCAGTGGATTTTTTTTGGTAACATTGTATCAA-TCTCATCACC
rJMSF008A09- TATATTCCTTTCCATTCTCAGTGGATTTTTTTTGGTAACATTGTATCAA-TCTCATCACC
JMFS056E04+ CAGTTTGGTGTAGCATTGCATCAA-TCTCATCACC
JMFS088C12+ CAGTTTGGTGTAGCATTGCATCAA-TCTCATCACC
JMFF044A19+ GTAGCA-TGCATCAATTCTCATCACC
JMFF018A12+ ATCAA-TNTCATCACC
rJMFF018A12- TATATTCCTTTCCATTCTCAGTGGATTTTTTTTGGTAACATTGTATCAA-TCTCATCACC
                      ____________________________________________________________
consensus TATATTCCTTTCCATTCTCAGTGGATTTTTTTTGGTAGCATTGTATCAA-TCTCATCACC
 
. : . : . : . : . : . :
rJMFF044A19- ATCTTCCATCTCTAGCTCATCTGGAGTCTGCTCCCATCGAAGAAAGCGACCATGAAACAG
rJMSF008A09- ATCTTCCATCTCTAGCTCATCTGGAGTCTGCTCCCATCGAAGAAAGCGACCATGAAACAG
JMFS056E04+ ATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCATCGAAGACGGCGACCATGAAACAG
JMFS088C12+ ATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCATCGAAGACGGCGACCATGAAACAG
JMFF044A19+ ATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCATCGAAGACGGCGACCATGAAACAG
JMFF018A12+ ATNTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCATCGAAGACGGCGACCATGAAACAG
rJMFF018A12- ATCTTCCATCTCTAGCTCATCTGGAGTCTGCTCCCATCGAAGAAAGCGACCATGAAACAG
                      ____________________________________________________________
consensus ATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCATCGAAGACGGCGACCATGAAACAG
 
. : . : . : . : . : . :
rJMFF044A19- GAAAGCTGTTGAATTAAGATCCATTGATTTGTGATCACAGTATGATTTCATGAGTCTCTT
rJMSF008A09- GAAAGCTGTTGAATTAAGATCCATTGATTTGTGATCACAGTATGATTTCATGAGTCTCTT
JMFS056E04+ GAAAGCTGTTGAATTAAGATCCATTGATTTGCGATCGCAGTATGATTTCATGAGTCTCTT
JMFS088C12+ GAAAGCTGTTGAATTAAGATCCATTGATTTGCGATCGCAGTATGATTTCATGAGTCTCTT
JMFF044A19+ GAAAGCTGTTGAATTAAGATCCATTGATTTGCGATCGCAGTATGATTTCATGAGTCTCTT
JMFF018A12+ GAAAGCTGTTGAATTAAGATCCATTGATTTGCGATCGCAGTATGATTTCATGAGTCTCNT
JMSF008A09+ ACAGTACGATTTCATGAGTCTCTT
rJMFF018A12- GAAAGCTGTTGAATTAAGATCCATTGATTTGTGATCACAGTATGATTTCATGAGTCTCTT
                      ____________________________________________________________
consensus GAAAGCTGTTGAATTAAGATCCATTGATTTGCGATCACAGTATGATTTCATGAGTCTCTT
 
. : . : . : . : . : . :
rJMFF044A19- CAGTCGGGTGCTTCTTTTCATCC-GAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
rJMSF008A09- CAGTCGGGTGCTTCTTTTCATCC-GAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
JMFS056E04+ CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
JMFS088C12+ CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
JMFF044A19+ CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
JMFF018A12+ CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCNTTCGTCGTTTCTGTCCTTT
JMSF008A09+ CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTCT
rJMFF018A12- CAGTCGGGTGCTTCTTTTCATCC-GAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
                      ____________________________________________________________
consensus CAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTCCTCCCTTCGTCGTTTCTGTCCTTT
 
. : . : . : . : . : . :
rJMFF044A19- GACTTTAAGGTTGATATGAGCGGCCTGGTCGCCGCAGACGGGCATCTTGTCTTCCTCTGC
rJMSF008A09- GACTTTAAGGTTGATATGAGCGGCCTGGTCGCCGCAGACGGGCATCTTGTCTTCCTCTGC
JMFS056E04+ GACTTTAAGGTTGATATGAGTGGCCTGGTTGCTGCAGACGGACATCTTGTCTTCCTCTGC
JMFS088C12+ GACTTTAAGGTTGATATGAGTGGCCTGGTTGCTGCAGACGGACATCTTGTCTTCCTCTGC
JMFF044A19+ GACTTTAAGGTTGATATGAGTGGCCTGGTTGCTGCAGACGGACATCTTGTCTTCCTCTGC
JMFF018A12+ GACTTTAAGGTTGATATGAGTGGCCTGGTTGCTGCAGACGGACATCTTGTCTTCCTCTGC
JMSF008A09+ GACTTTAAGGTTGATATGAGCGGCCAGATCGCCGCCGACGGGCATCTTGTCTTCCTCTGC
rJMFF018A12- GACTTTAAGGNTGATATGAGCGGCCTGGTCGCCGCAGACGGGCATCTTGTCTTCCTCTGC
                      ____________________________________________________________
consensus GACTTTAAGGTTGATATGAGCGGCCTGGTCGCCGCAGACGGGCATCTTGTCTTCCTCTGC
 
. : . : . : . : . : . :
rJMFF044A19- TCCGGCCGACATCTCTCTTCTGTCTTTGTGCACAATAAATTGCTTATGCACAGTTTGGTG
rJMSF008A09- TCCGGCCGACATCTCTCTTCTGTCTTTGTGCACAATAAATTGCTTATGCACAGTTTGGTG
JMFS056E04+ TCTGGCCGACATCTCTCTTCTGTCTTCGTGCACAATAAATTGCTTATGCACAGTTTGGTG
JMFS088C12+ TCTGGCCGACATCTCTCTTCTGTCTTCGTGCACAATAAATTGCTTATGCACAGTTTGGTG
JMFF044A19+ TCTGGCCGACATCTCTCTTCTGTCTTCGTGCACAATAAATTGCTTATGCACAGTTTGGTG
JMFF018A12+ TCTGGCCGACATCTCTCTTCTGTCTTCGTGCACAATAAATTGCTTATGCACAGTTTGGTG
JMSF008A09+ TCCGGCCGACATCTCACTTCTGTCTTCGTGCACAATAA
rJMFF018A12- TCCGGCCGACATCTCTCTTCTGTCTTTGTGCACAATAAATTGCTTATGCACAGTTTGGTG
                      ____________________________________________________________
consensus TCCGGCCGACATCTCTCTTCTGTCTTCGTGCACAATAAATTGCTTATGCACAGTTTGGTG
 
. : . : . : . : . : . :
rJMFF044A19- TAGCATTGCATCAATCTCATCACCATCTTCCATCT
rJMSF008A09- TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCCGGAGTCTGCTCCCA
JMFS056E04+ TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCA
JMFS088C12+ TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCA
JMFF044A19+ TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCA
JMFF018A12+ TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCA
rJMFF018A12- TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCCGGAGTCTGCTCCCA
                      ____________________________________________________________
consensus TAGCATTGCATCAATCTCATCACCATCTTCCATCTCCAGCTCATCTGGAGTCTGCTCCCA
 
. : . : . : . : . : . :
rJMSF008A09- TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGANCCACTGATTTGTGATC
JMFS056E04+ TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGATCCATTGATTTGCGATC
JMFS088C12+ TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGATCCATTGATTTGCGATC
JMFF044A19+ TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGATTCATTGATTTGCGATC
JMFF018A12+ TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGATTCATTGATTTGCGATC
rJMFF018A12- TCGAAGACGGCAACCATGAAACAGGAAAGCTGTTGAATTAAGATCCACTGATTTGTGATC
                      ____________________________________________________________
consensus TCGAAGACGGCGACCATGAAACAGGAAAGCTGTTGAATTAAGATCCATTGATTTGCGATC
 
. : . : . : . : . : . :
rJMSF008A09- ACAGTATGATTTCATGAGTTTCTTCAGTCGGGTGCTTCTTCTCATCCTGAAAATCAGTTC
JMFS056E04+ ACAGTACGATTTCATGAGTCTCTTCAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTC
JMFS088C12+ ACAGTACGATTTCATGAGTCTCTTCAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTC
JMFF044A19+ ACAGTACGATTTCATGAGTCTCTTCAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTC
JMFF018A12+ ACAGTACGATTTCATGAGTCTCTTCAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTC
rJMFF018A12- ACAGTATGATTTCATGAGTTTCTTCAGTCGGGTGCTTCTTCTCATCCTGAAAATCAGTTC
                      ____________________________________________________________
consensus ACAGTACGATTTCATGAGTCTCTTCAGTCGGGTGCTTCTTTTCATCCTGAAAATCAGTTC
 
. : . : . : . : . : . :
rJMSF008A09- CTCCCTTCGTCGTTTCTGTCCTTGGACTTTAAGGTTGATATGA
JMFS056E04+ CTCCCTTCGTCGTTTCTGTCCTCTGACTTTAAGGTTGATATGAG-CGGCCAGATCGCCGC
JMFS088C12+ CTCCCTTCGTCGTTTCTGTCCTCTGACTTTAAGGTTGATATGAG-CGGCCAGATCGCCGC
JMFF044A19+ CTCCCTTCGTCGTTTCTGTCCTCTGACTTTAAGGTTGATATGAG-CGGCCAGATCGCCGC
JMFF018A12+ CTCCCTTCGTCGTTTCTGTCCTCTGACTTTAAGGTTGATATGAG-CGGCCAGATCGCCGC
rJMFF018A12- CTCCCTTCGTCGNTTCTGTCCTTTGACTTTAAGGGTGATATGAGNGGGCCTGGTTGCTG-
                      ____________________________________________________________
consensus CTCCCTTCGTCGTTTCTGTCCTCTGACTTTAAGGTTGATATGAG-CGGCCAGATCGCCGC
 
. : . : . : . : . : . :
JMFS056E04+ CGACGGGCATCTTGTC-TTCCTCTG
JMFS088C12+ CGACGGGCATCTTGTC-TTCCTCTGCTCCGGCCGACATCTCACTTCTG
JMFF044A19+ CGACGGGCATCTTGTC-TTCCTCTGCTCCGGCCGACATCTCACTTCTGTCTTCGTGCACA
JMFF018A12+ CGACGGGCATCTTGTC-TTCCTCTGCTCCGGCCGACATCTCACTTCTGTCTTCGTGCACA
rJMFF018A12- CAAANNAAATCTTGTCTTTCCTCTGCTCCGGCCGAATTTTCTCTTCTGNANTGCTAAGCC
                      ____________________________________________________________
consensus CGACGGGCATCTTGTC-TTCCTCTGCTCCGGCCGACATCTCACTTCTGTCTTCGTGCACA
 
. : . : . : . : . : . :
JMFF044A19+ ATAA
JMFF018A12+ ATAA
rJMFF018A12- ACAGATTTGGNGNAGNATTGNATNAANTCCNNCNCATCTTCCANTTCCCGNTCNTCNNGA
                      ____________________________________________________________
consensus ATAAATTTGGNGNAGNATTGNATNAANTCCNNCNCATCTTCCANTTCCCGNTCNTCNNGA