Previous Contig 009038:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005E13Sequence487003974 (3)gb:AP005099_18478052e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN500009038 (2)gb:AY442257_16063350.042Populus alba x Populus tremula clone cET-1-pop1-409 predicted protein mRNA, comp
JMFF017P13Sequence580003974 (3)gb:AP005099_18478053e-16Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN744009038 (2)gb:AY442257_16063353e-14Populus alba x Populus tremula clone cET-1-pop1-409 predicted protein mRNA, comp

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017P13+ CCTACAAGGAAAAGGGGAATATCC
                      ____________________________________________________________
consensus CCTACAAGGAAAAGGGGAATATCC
 
. : . : . : . : . : . :
rJMFF017P13+ CGGACAAAAANCAACAGCATCATATGGANGGAGCAAAGTTCGGGACATGCTTGAGCCCGT
                      ____________________________________________________________
consensus CGGACAAAAANCAACAGCATCATATGGANGGAGCAAAGTTCGGGACATGCTTGAGCCCGT
 
. : . : . : . : . : . :
rJMFF017P13+ CCGGTCTTGATTCGTTGGAGCCCCATGACCTTCCTTTCGGACCGAGAATGTTTTATAATT
                      ____________________________________________________________
consensus CCGGTCTTGATTCGTTGGAGCCCCATGACCTTCCTTTCGGACCGAGAATGTTTTATAATT
 
. : . : . : . : . : . :
rJMFF017P13+ CACGGGAGGCGATACTCAGAAGAAAATTGGAGCAGGAGGCTGAGTTGCAGCAGGCCGTCG
                      ____________________________________________________________
consensus CACGGGAGGCGATACTCAGAAGAAAATTGGAGCAGGAGGCTGAGTTGCAGCAGGCCGTCG
 
. : . : . : . : . : . :
rJMFF005E13+ GACCAGAAGAATCATCCGAATT
rJMFF017P13+ AGCTTCAAGAACGAAGGCTGATGAATATGCAACTTGTGGACCAGAAGAATCATCCGAATT
                      ____________________________________________________________
consensus AGCTTCAAGAACGAAGGCTGATGAATATGCAACTTGTGGACCAGAAGAATCATCCGAATT
 
. : . : . : . : . : . :
rJMFF005E13+ ATCATCNNTTCCAGCCCGGCGGCTCATATCCCGGTATCCCGGTTCCTTCCATGAGCAACC
rJMFF017P13+ ATCATCACTTCCAGCCCGGCGGCTCATATCCCGGTATCCCGGTTCCTTCCATGAGCAACC
                      ____________________________________________________________
consensus ATCATCACTTCCAGCCCGGCGGCTCATATCCCGGTATCCCGGTTCCTTCCATGAGCAACC
 
. : . : . : . : . : . :
rJMFF005E13+ CGCTATCGCAAAACAATCAGGTTGTCCTCCTAGACAATGTGAAGCTTCCGCCCTGGGAAG
rJMFF017P13+ CGCTATCGCAAAACAATCAGGTTGTCCTCCTAGACAATGTGAAGCTTCCGCCCTGGGAAG
                      ____________________________________________________________
consensus CGCTATCGCAAAACAATCAGGTTGTCCTCCTAGACAATGTGAAGCTTCCGCCCTGGGAAG
 
. : . : . : . : . : . :
rJMFF005E13+ CGGGTGAAGTCCAAGAGAATGACGGTGGAAACGAAACTAGCAAGGAACCGAGCGCTAATC
rJMFF017P13+ CGGGTGAAGTCCAAGAGAATGACGGTGGGACCGAAACTAGCAAGGAACCGAGCGCTAATC
                      ____________________________________________________________
consensus CGGGTGAAGTCCAAGAGAATGACGGTGGGACCGAAACTAGCAAGGAACCGAGCGCTAATC
 
. : . : . : . : . : . :
rJMFF005E13+ ATGATGACCCGGAGCTAAACAAGAGCATGGAAAACATCCTTCCCGACAACCTTTTCGCTT
rJMFF017P13+ ATGATGACCCGGAGCTAAACAAGAGCATGGAAAACATCCTTCCCGACAACCTTTTCGCTT
                      ____________________________________________________________
consensus ATGATGACCCGGAGCTAAACAAGAGCATGGAAAACATCCTTCCCGACAACCTTTTCGCTT
 
. : . : . : . : . : . :
rJMFF005E13+ TCCCTACAAAATCCCCCGCTCCCGCAAATGCTGATGATGATAGCCCCTCGGATACACCTT
rJMFF017P13+ TCCCTACAAAATCCCCCGCTCCCGCAAATGCTGATGATGATAGCCCCTCGGATACACCTT
                      ____________________________________________________________
consensus TCCCTACAAAATCCCCCGCTCCCGCAAATGCTGATGATGATAGCCCCTCGGATACACCTT
 
. : . : . : . : . : . :
rJMFF005E13+ CTAATGACATCCCCGCGCTCTCTGCTACCTCCACCCTCAACATGGCGTCTCTTCAATCAT
rJMFF017P13+ CTAATGACATCCCCGCGCTCTCTGCTACCTCCACCCTCAACATGGCGTCTCTTCAATCAT
                      ____________________________________________________________
consensus CTAATGACATCCCCGCGCTCTCTGCTACCTCCACCCTCAACATGGCGTCTCTTCAATCAT
 
. : . : . : . : . : . :
rJMFF005E13+ GCGCCCTGAAGATGCCAAAGTTGACTTCCGGCCAAGAAGCCATCGAAGTGTAGGAAGAAG
rJMFF017P13+ GCGCCCTGAAGATGCCAAAGTTGACTTCCGGCCAAGAAGCCATCGAAGTGTAGGAAGAAG
                      ____________________________________________________________
consensus GCGCCCTGAAGATGCCAAAGTTGACTTCCGGCCAAGAAGCCATCGAAGTGTAGGAAGAAG
 
. : . : . : . : . : . :
rJMFF005E13+ TTCGATCTGGTCGATGGTTTATGGTTTAAAGTAAATCGCTCTCCCCCCCACTCTACCA
rJMFF017P13+ TTCGATCTGGTCGATGGTTTATGGTTTAAAGTAAATCGCTCTCCCCCCCACTCTACCATT
                      ____________________________________________________________
consensus TTCGATCTGGTCGATGGTTTATGGTTTAAAGTAAATCGCTCTCCCCCCCACTCTACCATT