Previous Contig 009032:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017N09Sequence575009032 (2)pir|E86391|E863919e-27T1K7.16 protein - Arabidopsis thaliana>gb:AE005172_891521 Arabidopsis thaliana c753009032 (2)pir|E86391|E863918e-34T1K7.16 protein - Arabidopsis thaliana>gb:AE005172_891521 Arabidopsis thaliana c

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017N09- AAAAATTCATTTCCAATTTCATGTTCATAACGT
rJMFF017N09+ AAAAATTCATTTCCAATTTCATGTTCATAACGT
                      ____________________________________________________________
consensus AAAAATTCATTTCCAATTTCATGTTCATAACGT
 
. : . : . : . : . : . :
JMFF017N09- TCCCAGCTTCCACAAATATATAGATACAGAATTGTGTATATGTGTATATAGCCCTCCTTC
rJMFF017N09+ TCCCAGCTTCCACAAATATATAGATACAGAATTGTGTATATGTGTATATAGCCCTCCTTC
                      ____________________________________________________________
consensus TCCCAGCTTCCACAAATATATAGATACAGAATTGTGTATATGTGTATATAGCCCTCCTTC
 
. : . : . : . : . : . :
JMFF017N09- AACTCTTCCATTCCAAGAGGCCAAAACACGGAATCAAAAGAGCGTTTTTGTGGAATCGCT
rJMFF017N09+ AACTCTTCCATTCCAAGAGGCCAAAACACGGAATCAAAAGAGCGTTTTTGTGGAATCGCT
                      ____________________________________________________________
consensus AACTCTTCCATTCCAAGAGGCCAAAACACGGAATCAAAAGAGCGTTTTTGTGGAATCGCT
 
. : . : . : . : . : . :
JMFF017N09- TCCGAAAACCGAAGAAAAATTCGGATCACGAAAATGGGTCAAAACACAGGGGCCAACAGT
rJMFF017N09+ TCCGAAAACCGAAGAAAAATTCGGATCACGAAAATGGGTCAAAACACAGGGGCCAACAGT
                      ____________________________________________________________
consensus TCCGAAAACCGAAGAAAAATTCGGATCACGAAAATGGGTCAAAACACAGGGGCCAACAGT
 
. : . : . : . : . : . :
JMFF017N09- AAAGGTAAGAAGGAAGAGGTGAAAAGGGAGCAGGTCGAGGAGGAGGAGGAGGAAGAAGAA
rJMFF017N09+ AAAGGTAAGAAGGAAGAGGTGAAAAGGGAGCAGGTCGAGGAGGAGGAGGAGGAAGAAGAA
                      ____________________________________________________________
consensus AAAGGTAAGAAGGAAGAGGTGAAAAGGGAGCAGGTCGAGGAGGAGGAGGAGGAAGAAGAA
 
. : . : . : . : . : . :
JMFF017N09- GAGCAGGAAGAACAGGACGGCGTGTCCGTACATTCTCCTTGCAAGCCTCCATCTTCATCT
rJMFF017N09+ GAGCAGGAAGAACAGGACGGCGTGTCCGTACATTCTCCTTGCAAGCCTCCATCTTCATCT
                      ____________________________________________________________
consensus GAGCAGGAAGAACAGGACGGCGTGTCCGTACATTCTCCTTGCAAGCCTCCATCTTCATCT
 
. : . : . : . : . : . :
JMFF017N09- CTCCGCAAGGAGCAATCGCAGGTGGAATTGGAGCTGAGGTTGCTGGAAGCTCTTGAAATC
rJMFF017N09+ CTCCGCAAGGAGCAATCGCAGGTGGAATTGGAGCTGAGGTTGCTGGAAGCTCTTGAAATC
                      ____________________________________________________________
consensus CTCCGCAAGGAGCAATCGCAGGTGGAATTGGAGCTGAGGTTGCTGGAAGCTCTTGAAATC
 
. : . : . : . : . : . :
JMFF017N09- TATCCTCCCGCCAAATTAAGAGGAGTTCATCGTCACTTTGTCCTTTATGGGTTAACAGAA
rJMFF017N09+ TATCCTCCCGCCAAATTAAGAGGAGTTCATCGTCACTTTGTCCTTTATGGGTTAACAGAA
                      ____________________________________________________________
consensus TATCCTCCCGCCAAATTAAGAGGAGTTCATCGTCACTTTGTCCTTTATGGGTTAACAGAA
 
. : . : . : . : . : . :
JMFF017N09- TATCTGCGAAGGAGTTTTAATAAGCACTTCACTGCCGCTGATGAATTGAAGTTGTTGGAT
rJMFF017N09+ TATCTGCGAAGGAGTTTTAATAAGCACTTCACTGCCGCTGATGAATTGAAGTTGTTGGAT
                      ____________________________________________________________
consensus TATCTGCGAAGGAGTTTTAATAAGCACTTCACTGCCGCTGATGAATTGAAGTTGTTGGAT
 
. : . : . : . : . : . :
JMFF017N09- CGCTTCTACAACTTGGAAATGCTGAAAGCAGACGATGATGAGGGAGAAATTCTGAATCAA
rJMFF017N09+ CGCTTCTACAACTTGGAAATGCTGAAAGCAGACGATGATGAGGGAGAAATTCTGAATCAA
                      ____________________________________________________________
consensus CGCTTCTACAACTTGGAAATGCTGAAAGCAGACGATGATGAGGGAGAAATTCTGAATCAA
 
. : . : . : . : . : . :
JMFF017N09- GA
rJMFF017N09+ GAGGAAGAATTTAGCTTGCCTCAAAGCTATTTCTCCAAGGAAGAATCTTAAATGTGTATG
                      ____________________________________________________________
consensus GAGGAAGAATTTAGCTTGCCTCAAAGCTATTTCTCCAAGGAAGAATCTTAAATGTGTATG
 
. : . : . : . : . : . :
rJMFF017N09+ ACAAAGCTAGGATCAAGTTTGTCTTTTTGTTTCCTTGATCGTTATCTTCAGACTACCTTT
                      ____________________________________________________________
consensus ACAAAGCTAGGATCAAGTTTGTCTTTTTGTTTCCTTGATCGTTATCTTCAGACTACCTTT
 
. : . : . : . : . : . :
rJMFF017N09+ TGTAGATTGTGATAACTTGGCAGGGAAACTGAATTTTGTCTTCAATATCCTAAATAAACA
                      ____________________________________________________________
consensus TGTAGATTGTGATAACTTGGCAGGGAAACTGAATTTTGTCTTCAATATCCTAAATAAACA