Previous Contig 009024:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002K09Sequence520009024 (30)gb:VVI237985_17275022e-42Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).714009024 (30)gb:VVI237985_17275029e-55Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF005K20Sequence500009024 (30)gb:VVI237985_17275026e-34Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).703009024 (30)gb:VVI237985_17275022e-53Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF010K05Sequence568009024 (30)gb:VVI237985_17275022e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).489009024 (30)gb:VVI237985_17275024e-42Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF011G16Sequence583009024 (30)gb:VVI237985_17275022e-45Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).686009024 (30)gb:VVI237985_17275025e-49Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF014B10Sequence441009024 (30)gb:VVI237985_17275029e-29Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).601009024 (30)gb:VVI237985_17275026e-46Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF017L06Sequence589009024 (30)pir|T09390|T093901e-4621K protein precursor - alfalfa>gb:MS11553_1687009 M.sativa mRNA for 21kD protei775009024 (30)gb:VVI237985_17275023e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF019P23Sequence520009024 (30)gb:VVI237985_17275022e-41Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).762009024 (30)gb:VVI237985_17275023e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF024O18Sequence447009024 (30)gb:VVI237985_17275023e-29Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).781009024 (30)gb:VVI237985_17275023e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF025D23Sequence517009024 (30)gb:VVI237985_17275021e-42Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).761009024 (30)gb:VVI237985_17275024e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF039N16Sequence562009024 (30)pir|T09390|T093903e-3821K protein precursor - alfalfa>gb:MS11553_1687009 M.sativa mRNA for 21kD protei610009024 (30)gb:VVI237985_17275027e-39Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF046B15Sequence514009024 (30)gb:VVI237985_17275027e-42Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).401009024 (30)gb:VVI237985_17275022e-23Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFF048C18Sequence248009024 (30)pir|T09390|T093901e-0621K protein precursor - alfalfa>gb:MS11553_1687009 M.sativa mRNA for 21kD protei
JMFN007K21Sequence631009024 (30)gb:VVI237985_17275022e-55Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFN008P21Sequence611009024 (30)gb:VVI237985_17275024e-49Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFN009E03Sequence247009024 (30)
JMFN009E15Sequence613009024 (30)gb:VVI237985_17275022e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFN032J06Sequence630009024 (30)gb:VVI237985_17275022e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFN032M24Sequence603009024 (30)gb:VVI237985_17275022e-54Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).
JMFN043L16Sequence606009024 (30)gb:VVI237985_17275026e-50Vitis vinifera mRNA for putative ripening-related protein (grip28 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN009E03- GAGAAC
                      ____________________________________________________________
consensus GAGAAC
 
. : . : . : . : . : . :
JMFN009E03- TAGTCTCGAGTTTTTTTTTTTTTTTAACCCAAATAGGCAAGGGTTGAAACCTTTTTAGGG
rJMFF046B15- GGCAAGGGTTGAAACCTTTTTAGGG
rJMFF014B10- TTTTAGGG
rJMFF039N16- GG
rJMFF005K20- TTTTTGGG
                      ____________________________________________________________
consensus TAGTCTCGAGTTTTTTTTTTTTTTTAACCCAAATAGGCAAGGGTTGAAACCTTTTTAGGG
 
. : . : . : . : . : . :
JMFN009E03- TATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF046B15- TATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF014B10- TATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF039N16- TATATTTATAACTTTAATTTGACGGANNATTTACAACAAAATTCCAAAGNCATCCAAGCA
rJMFF005K20- TATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF019P23- ATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF024O18- TATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF025D23- TTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF002K09- TTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF011G16- TTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
rJMFF017L06- TATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
                      ____________________________________________________________
consensus TATATTTATAACTTTAATTTGACGGACAATTTACAACAAAATTCCAAAGCCATCCAAGCA
 
. : . : . : . : . : . :
JMFN009E03- AACATGACTTAATGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF046B15- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF014B10- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF039N16- NACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF005K20- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF019P23- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF024O18- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF025D23- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF002K09- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
rJMFF011G16- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
JMFF010K05- CAAC
JMFN007K21+ CAACCTTAAAACGGACAAC
rJMFF017L06- AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
                      ____________________________________________________________
consensus AACATGACTTAGTGAAGTGCCTTTATAAAACACTAAACAGACAACCTTAAAACGGACAAC
 
. : . : . : . : . : . :
JMFN009E03- CTTAAAGCAGCTGACGACGTCTCAGGCTAGCTAGGTTGATTAATTGGACTTATAAGCGAA
rJMFF046B15- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF014B10- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF039N16- CTTAAAGCAGC-GACGACGTCTCAAGCTANCTAGGTTGATTAGTTGTACTTAGAAGCNAA
rJMFF005K20- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF019P23- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF024O18- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF025D23- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF002K09- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF011G16- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFF010K05- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF010K05+ AGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN007K21+ CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN032J06+ TAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN032M24+ TAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN009E15+ TCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN008P21+ CAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
JMFN043L16+ AGGTTGATTAGTTGTACTTAGAAGCGAA
rJMFF017L06- CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
                      ____________________________________________________________
consensus CTTAAAGCAGC-GACGACGTCTCAGGCTAGCTAGGTTGATTAGTTGTACTTAGAAGCGAA
 
. : . : . : . : . : . :
JMFN009E03- C
rJMFF046B15- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF014B10- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF039N16- CTGGNTGATTAGTGCCAAAGCATTGCTGGAGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF005K20- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF019P23- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF024O18- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF025D23- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF002K09- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF011G16- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFF010K05- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF010K05+ NTGGTTGATTAGTGCCAAAGCANTGCTGGTGACCTGGNCAACGTTGGTGACACGGNCCNG
JMFN007K21+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFN032J06+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFN032M24+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFN009E15+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFN008P21+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFN043L16+ CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACG-TGGTGACACGGGCCCG
JMFF039N16+ CTGGGCAACGTTGGTGACACGGGCCCG
JMFF017L06+ GATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
JMFF011G16+ AGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
rJMFF017L06- CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
                      ____________________________________________________________
consensus CTGGTTGATTAGTGCCAAAGCATTGCTGGTGACCTGGGCAACGTTGGTGACACGGGCCCG
 
. : . : . : . : . : . :
rJMFF046B15- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF014B10- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF039N16- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGNCGGCAAACCCGTCCATGCANGTGTT
rJMFF005K20- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF019P23- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF024O18- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF025D23- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF002K09- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF011G16- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF010K05- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF010K05+ AATGGAGGCCTTAATCTTNCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN007K21+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN032J06+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN032M24+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN009E15+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN008P21+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFN043L16+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF039N16+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF017L06+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF011G16+ AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF025D23+ TTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF005K20+ CCGGCAAACCCGTCCATGCAGGTGTT
JMFF002K09+ TCTTGCCGTTCAAGNCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
JMFF046B15+ TTCAAGGCCCGNCCGGCAAACCCGTCCATGCAGGTGTT
JMFF019P23+ TTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
rJMFF017L06- AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
                      ____________________________________________________________
consensus AATGGAGGCCTTAATCTTGCCGTTCAAGGCCCGGCCGGCAAACCCGTCCATGCAGGTGTT
 
. : . : . : . : . : . :
rJMFF046B15- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF014B10- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF039N16- CTCGTCNGTGAGGGCGGCNCTAATCCACNTCTGGGCATTGCTGATGTGCCACTGGAANTC
rJMFF005K20- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF019P23- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF024O18- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF025D23- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF002K09- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF011G16- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF010K05- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF010K05+ CTNGTCGGTGAGGGCGGCGCTAATCCANGTCTGGNCATTGCNGATGTGNCACTGGAAGNC
JMFN007K21+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFN032J06+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFN032M24+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFN009E15+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFN008P21+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFN043L16+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF039N16+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF017L06+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF011G16+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF025D23+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF005K20+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF014B10+ GGGCATTGNTGATGTGCCACTGGAAGTC
JMFF002K09+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF046B15+ CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
JMFF019P23+ CTNGTCGGTGAGGGCGGCGNTAATCCACGTCTGGGCATTGNTGATGTGCCACTGGAAGTC
JMFF024O18+ CTGGGCATTGCTGATGTGCCACTGGAAGTC
rJMFF017L06- CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
                      ____________________________________________________________
consensus CTCGTCGGTGAGGGCGGCGCTAATCCACGTCTGGGCATTGCTGATGTGCCACTGGAAGTC
 
. : . : . : . : . : . :
rJMFF046B15- CCGGCCCATGTTCTTGA
rJMFF014B10- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF039N16- CCGGNCCATGTTCTTGAGCTCCCGGACCNATTTGCT-CAGCCGGTCCACGCTGNCACTCA
rJMFF005K20- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF019P23- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF024O18- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF025D23- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF002K09- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF011G16- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF010K05- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF010K05+ CCGGCCCATGTTNTTGAGCTCCCGGACCGATTTGNT-CAGCCGGTCCACGCTGTCACTCA
JMFN007K21+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFN032J06+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFN032M24+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFN009E15+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFN008P21+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFN043L16+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF039N16+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCTCCAGCCGGTCCACGCTGTCACTCA
JMFF017L06+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCTCCAGCCGGTCCACGCTGTCACTCA
JMFF011G16+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF025D23+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF005K20+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF014B10+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF002K09+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF046B15+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF019P23+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
JMFF024O18+ CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
rJMFF017L06- CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
                      ____________________________________________________________
consensus CCGGCCCATGTTCTTGAGCTCCCGGACCGATTTGCT-CAGCCGGTCCACGCTGTCACTCA
 
. : . : . : . : . : . :
rJMFF014B10- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF039N16- TCTCGTCCAGGCANTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTNC
rJMFF005K20- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACCCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF019P23- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF024O18- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF025D23- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF002K09- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF011G16- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF010K05- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF010K05+ TCTCGTCCAGGCAGTCTNTNAGAGCCCCATACTNTNTGCGCTTCAACCCTTTGAACTTGC
JMFN007K21+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFN032J06+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFN032M24+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFN009E15+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFN008P21+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFN043L16+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF039N16+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF017L06+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF011G16+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF025D23+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF005K20+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACCCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF014B10+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF002K09+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF046B15+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF019P23+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
JMFF024O18+ TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
rJMFF017L06- TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
                      ____________________________________________________________
consensus TCTCGTCCAGGCAGTCTTTCAGAGCCCCATACTCTCTGCGCTTCAACCCTTTGAACTTGC
 
. : . : . : . : . : . :
rJMFF014B10- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF039N16- ANAGNTTGTCGACTAANCCCTTGGTGGATTGGGNCCGGTCCACGCTCACGGACAGGGCCG
rJMFF005K20- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF019P23- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF024O18- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF025D23- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF002K09- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF011G16- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF010K05- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF010K05+ AGAGCTTGTCGACGAAGCCCNTGNTGGATTGGNCCCGGTCCACGCTCACGGACAGGGCNG
JMFN007K21+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFN032J06+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFN032M24+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFN009E15+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFN008P21+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFN043L16+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF039N16+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF017L06+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF011G16+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF025D23+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF005K20+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF014B10+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF048C18+ GACAGGGCCG
JMFF002K09+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF046B15+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF019P23+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
JMFF024O18+ AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
rJMFF017L06- AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
                      ____________________________________________________________
consensus AGAGCTTGTCGACGAAGCCCTTGGTGGATTGGGCCCGGTCCACGCTCACGGACAGGGCCG
 
. : . : . : . : . : . :
rJMFF014B10- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGNACGCCGCCAGG
rJMFF039N16- TCTGCAC-TANCTGCTGCGGGCTTCGNTTGATGGTCNGGCCGTACGCCGCCACGGAAGTG
rJMFF005K20- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF019P23- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF024O18- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF025D23- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF002K09- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF011G16- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCA-GGAAGTG
JMFF010K05- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF010K05+ TCTGCAC-TAGCTGNTGCGGGCTTCGCTTGATGGTNGGGCCGTACGCCGCCAGGGAAGTG
JMFN007K21+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFN032J06+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFN032M24+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFN009E15+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFN008P21+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFN043L16+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF039N16+ TCTGCACTAAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF017L06+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF011G16+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCA-GGAAGTG
JMFF025D23+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF005K20+ TCTGCACTTAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF014B10+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF048C18+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF002K09+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF046B15+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF019P23+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
JMFF024O18+ TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
rJMFF017L06- TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
                      ____________________________________________________________
consensus TCTGCAC-TAGCTGCTGCGGGCTTCGCTTGATGGTCGGGCCGTACGCCGCCAGGGAAGTG
 
. : . : . : . : . : . :
rJMFF039N16- ACGCATAGATC
rJMFF005K20- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF019P23- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF024O18- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF025D23- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF002K09- ACGCATAGATCAGGGTACGTGGTGGCTTTGCANGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF011G16- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF010K05- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGANGTCTTGATGAAGCTCGTANCAACC
rJMFF010K05+ ANGCATAGATCAGGGTACGTGGTGGCTTNGCAGGAGGTC
JMFN007K21+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFN032J06+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFN032M24+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFN009E15+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFN008P21+ ACGCAT-GATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFN043L16+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF039N16+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF017L06+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF011G16+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF025D23+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF005K20+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF014B10+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF048C18+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF002K09+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF046B15+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF019P23+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
JMFF024O18+ ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
rJMFF017L06- ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
                      ____________________________________________________________
consensus ACGCATAGATCAGGGTACGTGGTGGCTTTGCAGGAGGTCTTGATGAAGCTCGTAGCAACC
 
. : . : . : . : . : . :
rJMFF005K20- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATAC
rJMFF019P23- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
rJMFF024O18- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
rJMFF025D23- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACNAGATAGAAAGCACCACCACCGCC
rJMFF002K09- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
rJMFF011G16- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACAT
JMFF010K05- GTCGCCGCCGCCGACTCCGCCGTGTC
JMFN007K21+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFN032J06+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFN032M24+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFN009E15+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFN008P21+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFN043L16+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF039N16+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF017L06+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF011G16+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF025D23+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF005K20+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF014B10+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF048C18+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAGCATACAAGATAGAAAGCACCACCACCGCC
JMFF002K09+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF046B15+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF019P23+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
JMFF024O18+ GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
rJMFF017L06- GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
                      ____________________________________________________________
consensus GTCGCCGCCGCCGACTCCGCCGTGTCGGAAACATACAAGATAGAAAGCACCACCACCGCC
 
. : . : . : . : . : . :
rJMFF019P23- ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGC
rJMFF024O18- ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
rJMFF025D23- ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAG
rJMFF002K09- A
JMFN007K21+ ACAGCTTGAACCAAC
JMFN032J06+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTAC
JMFN032M24+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACT
JMFN009E15+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACT
JMFN008P21+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACT
JMFN043L16+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGA
JMFF039N16+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF017L06+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTG
JMFF011G16+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF025D23+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF005K20+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGA
JMFF014B10+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF048C18+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF002K09+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTG
JMFF046B15+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTG
JMFF019P23+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTT
JMFF024O18+ ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTG
rJMFF017L06- ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTGCGGT
                      ____________________________________________________________
consensus ACAGCTTGAACCAACACTCTCGCCATTTTCTTTACTTATGACAGGCAGAGATCTTGCGGT