Previous Contig 009011:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017I16Sequence407001165 (3)gb:AB107693_15267511e-44Nicotiana tabacum AGP5 mRNA for AG-motif binding protein-5, complete cds.730009011 (2)gb:AB107689_15267474e-39Nicotiana tabacum AGP1 mRNA for AG-motif binding protein-1, complete cds.
JMFF024A05Sequence566001165 (3)gb:AB107693_15267513e-46Nicotiana tabacum AGP5 mRNA for AG-motif binding protein-5, complete cds.712009011 (2)gb:AB107689_15267471e-39Nicotiana tabacum AGP1 mRNA for AG-motif binding protein-1, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024A05+ CCCGAGCAGAAGAAGAAAAAGAAGATCAAATTCACCATCCCCATCGCCCCA
rJMFF017I16+ CCCATCGCCCCA
                      ____________________________________________________________
consensus CCCGAGCAGAAGAAGAAAAAGAAGATCAAATTCACCATCCCCATCGCCCCA
 
. : . : . : . : . : . :
rJMFF024A05+ GTGGACACGAACCAGAACCAGCCACCACAAGCCATCAGAAAATGCTTGCACTGCGAGATA
rJMFF017I16+ GTGGACACGAACCAGAACCAGCCACCACAAGCCATCAGAAAATGCTTGCACTGCGAGATA
                      ____________________________________________________________
consensus GTGGACACGAACCAGAACCAGCCACCACAAGCCATCAGAAAATGCTTGCACTGCGAGATA
 
. : . : . : . : . : . :
rJMFF024A05+ ACAAAAACGCCTCAATGGAGGGCCGGTCCAATGGGGCCAAAAACCCTGTGCAATGCCTGT
rJMFF017I16+ ACAAAAACGCCTCAATGGAGGGCCGGTCCAATGGGGCCAAAAACCCTGTGCAATGCCTGT
                      ____________________________________________________________
consensus ACAAAAACGCCTCAATGGAGGGCCGGTCCAATGGGGCCAAAAACCCTGTGCAATGCCTGT
 
. : . : . : . : . : . :
rJMFF024A05+ GGCGTTCGCTACAAGTCGGGCAGGCTCTTCCCAGAATACCGCCCCGCTGCAAGTCCTACC
rJMFF017I16+ GGCGTTCGCTACAAGTCGGGCAGGCTCTTCCCAGAATACCGCCCCGCTGCAAGTCCTACC
                      ____________________________________________________________
consensus GGCGTTCGCTACAAGTCGGGCAGGCTCTTCCCAGAATACCGCCCCGCTGCAAGTCCTACC
 
. : . : . : . : . : . :
rJMFF024A05+ TTCACCCCGTCTCTCCACTCCAACTCTCACAAGAAGGTTATCGAGATGAGAAGCAAGGTT
rJMFF017I16+ TTCACCCCGTCTCTCCACTCCAACTCTCACAAGAAGGTTATCGAGATGAGAAGCAAGGTT
                      ____________________________________________________________
consensus TTCACCCCGTCTCTCCACTCCAACTCTCACAAGAAGGTTATCGAGATGAGAAGCAAGGTT
 
. : . : . : . : . : . :
rJMFF024A05+ GGTGTCGAGAACACTGCAATAACCGAGGCACCATCCACTCCCCAGCCAGCATTCAACAAC
rJMFF017I16+ GGTGTCGAGAACACTGCAATAACCGAGGCACCATCCACTCCCCAGCCAGCATTCAACAAC
                      ____________________________________________________________
consensus GGTGTCGAGAACACTGCAATAACCGAGGCACCATCCACTCCCCAGCCAGCATTCAACAAC
 
. : . : . : . : . : . :
rJMFF024A05+ CCTTCAGTGGAATTCTAGCAAGAATACACTTGAAAAACCGAAAGGTGCAGAGAATGGTTT
rJMFF017I16+ CCTTCAGTGGAATTCTAGCAAGAATACACTTGAAAAACCGAAAGGTGC--AGAATGGTTT
                      ____________________________________________________________
consensus CCTTCAGTGGAATTCTAGCAAGAATACACTTGAAAAACCGAAAGGTGCAGAGAATGGTTT
 
. : . : . : . : . : . :
rJMFF024A05+ TCATAGTCAAAAGCTCTCTCTCTGCATTCCTCGATCATACCACAGTTTCAGCAGAGTTAA
rJMFF017I16+ TCATAGTCAAAAGCTCTCTCTCTGCATTCCTCGATCATACCACAGTTTCAGCAGAGTTAA
                      ____________________________________________________________
consensus TCATAGTCAAAAGCTCTCTCTCTGCATTCCTCGATCATACCACAGTTTCAGCAGAGTTAA
 
. : . : . : . : . : . :
rJMFF024A05+ TGTTATTTGGTTAAGGTTTTCTTCAAACTTTGGTGTCTTTAATTTGTTATTTGGTTCTTT
rJMFF017I16+ TGTTATTTGGTTAAGGTTTTCTTCAAACTTTGGTGTCTTTAATTTGTTATTTGGTTCTTT
                      ____________________________________________________________
consensus TGTTATTTGGTTAAGGTTTTCTTCAAACTTTGGTGTCTTTAATTTGTTATTTGGTTCTTT
 
. : . : . : . : . : . :
rJMFF024A05+ GTACAAATTTGTAATTGGAGGGAGGGGTTGGAAAGAAGCAATAGATCCATAATATTTTAG
rJMFF017I16+ GTACAAATTTGTAATTGGAGGGAGGGGTTGGAAAGAAGCAATAGATCCATAATATTTTAG
                      ____________________________________________________________
consensus GTACAAATTTGTAATTGGAGGGAGGGGTTGGAAAGAAGCAATAGATCCATAATATTTTAG
 
. : . : . : . : . : . :
rJMFF024A05+ GTTGTAGGGAAAGAAAAGGAATGAAATGTGAGTTTAGGGGTAGGAGTTAAAAAAGTAGTA
rJMFF017I16+ GTTGTAGGGAAAGAAAAGGAATGAAATGTGAGTTTAGGGGTAGGAGTTAAAAAAGTAGTA
                      ____________________________________________________________
consensus GTTGTAGGGAAAGAAAAGGAATGAAATGTGAGTTTAGGGGTAGGAGTTAAAAAAGTAGTA
 
. : . : . : . : . : . :
rJMFF024A05+ GTTTGTAGTGTTGGTTAGTTTCTTCAAAGGGTCTGTTGTATGTTTTTCATAGACTTTGTT
rJMFF017I16+ GTTTGTAGTGTTGGTTAGTTTCTTCAAAGGGTCTGTTGTATGTTTTTCATAGACTTTGTT
                      ____________________________________________________________
consensus GTTTGTAGTGTTGGTTAGTTTCTTCAAAGGGTCTGTTGTATGTTTTTCATAGACTTTGTT
 
. : . : . : . : . : . :
rJMFF024A05+ C
rJMFF017I16+ CTGTCCCATGTTTTGTGGGAATTCATTTTGCAGTTCATTTGTGGTTTAGGAAATTATGAA
                      ____________________________________________________________
consensus CTGTCCCATGTTTTGTGGGAATTCATTTTGCAGTTCATTTGTGGTTTAGGAAATTATGAA