Previous Contig 009006:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017G15Sequence571000426 (3)pir|S62667|S626672e-54Nramp1 protein - rice>gb:RICNRAMP_1703695 Oryza Sativa integral membrane protein797009006 (3)gb:AY724413_16243841e-58Malus baccata root-specific metal transporter (Nramp1) mRNA, complete cds.
JMFF037K16Sequence532000426 (3)pir|S62667|S626671e-50Nramp1 protein - rice>gb:RICNRAMP_1703695 Oryza Sativa integral membrane protein716009006 (3)gb:AY724413_16243842e-54Malus baccata root-specific metal transporter (Nramp1) mRNA, complete cds.
JMFN017M13Sequence626009006 (3)gb:AY724413_16243845e-49Malus baccata root-specific metal transporter (Nramp1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF017G15+ CTCAGCTGCATTTCTGC
                      ____________________________________________________________
consensus CTCAGCTGCATTTCTGC
 
. : . : . : . : . : . :
rJMFF037K16+ TGGCATCA
rJMFF017G15+ TTAAGGATTCTCTAGGGGAAATGGAGTTCAAAGCTTTATGCTGTGTCTTTGTTGGCATCA
                      ____________________________________________________________
consensus TTAAGGATTCTCTAGGGGAAATGGAGTTCAAAGCTTTATGCTGTGTCTTTGTTGGCATCA
 
. : . : . : . : . : . :
rJMFF037K16+ GGTCAGAGTTCATCAGTCACAGGGACATTTGCTGGCCAGTATATAATGCAGGGGTTTTTG
JMFN017M13- CATTTGCTGGCCAGTATATAATGCAGGGGTTTTTG
rJMFF017G15+ GGTCAGAGTTCATCAGTCACAGGGACATTTGCTGGCCAGTATATAATGCAGGGGTTTTTG
                      ____________________________________________________________
consensus GGTCAGAGTTCATCAGTCACAGGGACATTTGCTGGCCAGTATATAATGCAGGGGTTTTTG
 
. : . : . : . : . : . :
rJMFF037K16+ GATCTGAAAATGAAGCTATGGCTGCGAAATTTGCTCACCAGGTGCATAGCAATTGCGCCA
JMFN017M13- GATCTGAAAATGAAGCTATGGCTGCGAAATTTGCTCACCAGGTGCATAGCAATTGCGCCA
rJMFF017G15+ GATCTGAAAATGAAGCTATGGCTGCGAAATTTGCTCACCAGGTGCATAGCAATTGCGCCA
                      ____________________________________________________________
consensus GATCTGAAAATGAAGCTATGGCTGCGAAATTTGCTCACCAGGTGCATAGCAATTGCGCCA
 
. : . : . : . : . : . :
rJMFF037K16+ AGTTTAATGGTCTGCGTCATCGGCGGATCTTCTGGAGCTGGGAAGCTAATTATTATTGCT
JMFN017M13- AGTTTAATGGTCTGCGTCATCGGCGGATCTTCTGGAGCTGGGAAGCTAATTATTATTGCT
rJMFF017G15+ AGTTTAATGGTCTGCGTCATCGGCGGATCTTCTGGAGCTGGGAAGCTAATTATTATTGCT
                      ____________________________________________________________
consensus AGTTTAATGGTCTGCGTCATCGGCGGATCTTCTGGAGCTGGGAAGCTAATTATTATTGCT
 
. : . : . : . : . : . :
rJMFF037K16+ TCTATGATTTTATCATTTGAACTACCATTTGCACTGGTTCCTCTTCTTAGGTTTACCAGC
JMFN017M13- TCTATGATTTTATCATTTGAACTACCATTTGCACTGGTTCCTCTTCTTAGGTTTACCAGC
rJMFF017G15+ TCTATGATTTTATCATTTGAACTACCATTTGCACTGGTTCCTCTTCTTAGGTTTACCAGC
                      ____________________________________________________________
consensus TCTATGATTTTATCATTTGAACTACCATTTGCACTGGTTCCTCTTCTTAGGTTTACCAGC
 
. : . : . : . : . : . :
rJMFF037K16+ AGTGGAAGCAAAATGGGGCAGCATAAAAACTCTAAGATGGTAACAGTGATCACATGGCTA
JMFN017M13- AGTGGAAGCAAAATGGGGCAGCATAAAAACTCTAAGATGGTAACAGTGATCACATGGCTA
rJMFF017G15+ AGTGGAAGCAAAATGGGGCAGCATAAAAACTCTAAGATGGTAACAGTGATCACATGGCTA
                      ____________________________________________________________
consensus AGTGGAAGCAAAATGGGGCAGCATAAAAACTCTAAGATGGTAACAGTGATCACATGGCTA
 
. : . : . : . : . : . :
rJMFF037K16+ CTAGGATTCTGCTCAATTGGGGTCAACATCTATTTCTTAAGCAGAAGTTTGTTTGGGTGG
JMFN017M13- CTAGGATTCTGCTCAATTGGGGTCAACATCTATTTCTTAAGCAGAAGTTTGTTTGGGTGG
rJMFF017G15+ CTAGGATTCTGCTCAATTGGGGTCAACATCTATTTCTTAAGCAGAAGTTTGTTTGGGTGG
                      ____________________________________________________________
consensus CTAGGATTCTGCTCAATTGGGGTCAACATCTATTTCTTAAGCAGAAGTTTGTTTGGGTGG
 
. : . : . : . : . : . :
rJMFF037K16+ CTTACCAGCAAAAAGATGCCCAGGGCTGTATCCATCTTCTCCACAGTAATGATCTGTCCA
JMFN017M13- CTTACCAGCAAAAAGATGCCCAGGGCTGTATCCATCTTCTCCACAGTAATGATCTGTCCA
rJMFF017G15+ CTTACCAGCAAAAAGATGCCCAGGGCTGTATCCATCTTCTCCACAGTAATGATCTGTCCA
                      ____________________________________________________________
consensus CTTACCAGCAAAAAGATGCCCAGGGCTGTATCCATCTTCTCCACAGTAATGATCTGTCCA
 
. : . : . : . : . : . :
rJMFF037K16+ GTAATGGTGCTTTATGTTGCAATGCTGGCCTACTTGACGCTGAAGCCAGAAGCTACAAGC
JMFN017M13- GTAATGGTGCTTTATGTTGCAATGCTGGCCTACTTGACGCTGAAGCCAGAAGCTACAAGC
rJMFF017G15+ GTAATGGTGCTTTATGTTGCAATGCTGGCCTACTTGACGCTGAAGCCAGAAGCTACAAGC
                      ____________________________________________________________
consensus GTAATGGTGCTTTATGTTGCAATGCTGGCCTACTTGACGCTGAAGCCAGAAGCTACAAGC
 
. : . : . : . : . : . :
rJMFF037K16+ AAGAGTGTCCAATCTTCTGAAGCAAGTTCTACTGGGACTGTTGAAATGGAGCTAGAGCAA
JMFN017M13- AAGAGTGTCCAATCTTCTGAAGCAAGTTCTACTGGGACTGTTGAAATGGAGCTAGAGCAA
rJMFF017G15+ AAGAGTGTCCAATCTTCTGAAGCAAGTTCTACTGGGACTGTTGAAATGGAGCTAGAGCAA
                      ____________________________________________________________
consensus AAGAGTGTCCAATCTTCTGAAGCAAGTTCTACTGGGACTGTTGAAATGGAGCTAGAGCAA
 
. : . : . : . : . : . :
rJMFF037K16+ GGTGCTGACTTCAAAACTCCGATGTAGCTGATGAGATTTAGAAGGATGATCTAGTCCCTC
JMFN017M13- GGTGCTGACTTCAAAACTCCGATGTAGCTGATGAGATTTAGAAGGATGATCTAGTCCCTC
rJMFF017G15+ GGTGCTGACTTCAAAACTCCGATGTAGCTGATGAGATTTAGAAGGATGATCTAGTCCCTC
                      ____________________________________________________________
consensus GGTGCTGACTTCAAAACTCCGATGTAGCTGATGAGATTTAGAAGGATGATCTAGTCCCTC
 
. : . : . : . : . : . :
rJMFF037K16+ TGTAGGACACAAGTTCTTCACCATCCCCACCGCATTATATAATATTCTTCAGTAGTAATC
JMFN017M13- TGTAGGACACAAGTTTTTCACCATCCCCACCGCATTATATAATATTCTTCA
rJMFF017G15+ TGTAGGACACAAGTTCTTCACCATCCCCACCGCATTATATAATATTCTTCAGTAGTAATC
                      ____________________________________________________________
consensus TGTAGGACACAAGTTCTTCACCATCCCCACCGCATTATATAATATTCTTCAGTAGTAATC
 
. : . : . : . : . : . :
rJMFF037K16+ AAAAGAATAAATTACAGTAAAGAATAAATCTGTAGTGACTTACAGGGG
rJMFF017G15+ AAAAGAATAAATTACAGTAAAGAATAAATCTGTAGTGACTTACAGGGGTAAATTTCAACT
                      ____________________________________________________________
consensus AAAAGAATAAATTACAGTAAAGAATAAATCTGTAGTGACTTACAGGGGTAAATTTCAACT