Previous Contig 009004:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017F21Sequence588009004 (6)gb:AB195273_15296858e-53Arabidopsis thaliana gene for BBMII isomerase, complete cds.798009004 (6)gb:AB195273_15296851e-86Arabidopsis thaliana gene for BBMII isomerase, complete cds.
JMFF034G11Sequence584009004 (6)gb:AB195273_15296853e-28Arabidopsis thaliana gene for BBMII isomerase, complete cds.743009004 (6)gb:AB195273_15296857e-96Arabidopsis thaliana gene for BBMII isomerase, complete cds.
JMSF049O04Sequence680009004 (6)gb:AB195273_15296853e-31Arabidopsis thaliana gene for BBMII isomerase, complete cds.734009004 (6)gb:AB195273_15296852e-96Arabidopsis thaliana gene for BBMII isomerase, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF049O04- GGGAGCTAAGCTGCTTAGGTA
                      ____________________________________________________________
consensus GGGAGCTAAGCTGCTTAGGTA
 
. : . : . : . : . : . :
JMSF049O04- ATGCACAGTAACGACGCCCAAAATCCACTCCTTCGTTCAGTAGTCCTCCAACTGTTTGAT
                      ____________________________________________________________
consensus ATGCACAGTAACGACGCCCAAAATCCACTCCTTCGTTCAGTAGTCCTCCAACTGTTTGAT
 
. : . : . : . : . : . :
JMSF049O04- GAATTGTAGATCAAAATTGGGAAGAATTGTAGATCAAAATTGCCTATTACTTGCTATTTC
                      ____________________________________________________________
consensus GAATTGTAGATCAAAATTGGGAAGAATTGTAGATCAAAATTGCCTATTACTTGCTATTTC
 
. : . : . : . : . : . :
JMSF049O04- CACGCACACACACACCATAAATATGTATGTATTATGTATATGCGTTGGCGAATGGGTGTG
                      ____________________________________________________________
consensus CACGCACACACACACCATAAATATGTATGTATTATGTATATGCGTTGGCGAATGGGTGTG
 
. : . : . : . : . : . :
JMSF049O04- AAAATGTATATCACTGCGTGTTTTTAGACTGATTAGCAATGCAATTTTAGTAGGTATTTG
JMFF034G11- GTATTTG
JMFF017F21- GTATTTG
                      ____________________________________________________________
consensus AAAATGTATATCACTGCGTGTTTTTAGACTGATTAGCAATGCAATTTTAGTAGGTATTTG
 
. : . : . : . : . : . :
JMSF049O04- AACTGAGCTGAGTCCAAGGATGAGAGTTCAGAGCCTAGGTGCAAATTCGGCCTCCTCGAA
JMFF034G11- AACTGAGCTGAGTCCAAGGATGAGAGTTCAGAGCCTAGGTGCAAATTCGGCCTCCTCGAA
JMFF017F21- AACTGAGCTGAGTCCAAGGATGAGAGTTCAGAGCCTAGGTGCAAATTCGGCCTCCTCGAA
                      ____________________________________________________________
consensus AACTGAGCTGAGTCCAAGGATGAGAGTTCAGAGCCTAGGTGCAAATTCGGCCTCCTCGAA
 
. : . : . : . : . : . :
JMSF049O04- ACTAAGCTCATTTTGGGGGAAAACTCTCAGCTCACCAATCCACGTTCATAACAAAAACAT
JMFF034G11- ACTAAGCTCATTTTGGGGGAAAACTCTCAGCTCACCAATCCACGTTCATAACAAAAACAT
JMFF017F21- ACTAAGCTCATTTTGGGGGAAAACTCTCAGCTCACCAATCCACGTTCATAACAAAAACAT
                      ____________________________________________________________
consensus ACTAAGCTCATTTTGGGGGAAAACTCTCAGCTCACCAATCCACGTTCATAACAAAAACAT
 
. : . : . : . : . : . :
JMSF049O04- AAGATTCCCAATCATTGGGTGCCATAATCTGTCAATAAAATGCGGTGTTCGGTTTCGCCC
JMFF034G11- AAGATTCCCAATCATTGGGTGCCATAATCTGTCAATAAAATGCGGTGTTCGGTTTCGCCC
JMFF017F21- AAGATTCCCAATCATTGGGTGCCATAATCTGTCAATAAAATGCGGTGTTCGGTTTCGCCC
                      ____________________________________________________________
consensus AAGATTCCCAATCATTGGGTGCCATAATCTGTCAATAAAATGCGGTGTTCGGTTTCGCCC
 
. : . : . : . : . : . :
JMSF049O04- TTGCATTGATATACACAAGGGAAAAGT-AAAGCAGATTGTTGGATCCACACTAAATGATA
JMFF034G11- TTGCATTGATATACACAAGGGAAAAGTAAAAGCAGATTGTTGGATCCACACTAAATGATA
JMFF017F21- TTGCATTGATATACACAAGGGAAAAGT-AAAGCAGATTGTTGGATCCACACTAAATGATA
                      ____________________________________________________________
consensus TTGCATTGATATACACAAGGGAAAAGT-AAAGCAGATTGTTGGATCCACACTAAATGATA
 
. : . : . : . : . : . :
JMSF049O04- CTAAGGATGGGGATTCGAGTCTTGTAACCAATTTCGTATCTGATAACTCGGCTGGAGTGT
JMFF034G11- CTAAGGATGGGGATTCGAGTCTTGTAACCAATTTCGTATCTGATAACTCGGCTGGAGTGT
JMFF017F21- CTAAGGATGGGGATTCGAGTCTTGTAACCAATTTCGTATCTGATAACTCGGCTGGAGTGT
rJMSF049O04+ TCGGCTGGAGTGT
rJMFF034G11+ GGAGTGT
                      ____________________________________________________________
consensus CTAAGGATGGGGATTCGAGTCTTGTAACCAATTTCGTATCTGATAACTCGGCTGGAGTGT
 
. : . : . : . : . : . :
JMSF049O04- ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
JMFF034G11- ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
JMFF017F21- ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
rJMSF049O04+ ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
rJMFF034G11+ ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
rJMFF017F21+ TAATAATGCTTGGAGCGG
                      ____________________________________________________________
consensus ATGCAAAGCTTTACAAAGATGACGGACTTAAAGGTGGTCATGTAATAATGCTTGGAGCGG
 
. : . : . : . : . : . :
JMSF049O04- ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
JMFF034G11- ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
JMFF017F21- ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
rJMSF049O04+ ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
rJMFF034G11+ ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
rJMFF017F21+ ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
                      ____________________________________________________________
consensus ACCCTTTGAGCCAAGCAGCAGCAATTGAAGCAATACATGCTTATCCTGGTGGCTTGCATG
 
. : . : . : . : . : . :
JMFF034G11- TTGGA
JMFF017F21- TTGGAGGAGGTATCAATTCAAACAATGCAGTAAGTTACATAGAAGCAGGAGCAAGCCATG
rJMSF049O04+ TTGGAGGAGGTATCAATTCAAACAATGCAGTAAGTTACATAGAAGCAGGAGCAAGCCATG
rJMFF034G11+ TTGGAGGAGGTATCAATTCAAACAATGCAGTAAGTTACATAGAAGCAGGAGCAAGCCATG
rJMFF017F21+ TTGGAGGAGGTATCAATTCAAACAATGCAGTAAGTTACATAGAAGCAGGAGCAAGCCATG
                      ____________________________________________________________
consensus TTGGAGGAGGTATCAATTCAAACAATGCAGTAAGTTACATAGAAGCAGGAGCAAGCCATG
 
. : . : . : . : . : . :
JMFF017F21- TCATTGTTACATCTTATGTCTTCAACAATGGGCAAATGGACCTTGACAAACTGAAAGAGC
rJMSF049O04+ TCATTGTTACATCTTATGTCTTCAACAATGGGCAAATGGACCTTGACAAACTGAAAGAGC
rJMFF034G11+ TCATTGTTACATCTTATGTCTTCAACAATGGGCAAATGGACCTTGACAAACTGAAAGAGC
rJMFF017F21+ TCATTGTTACATCTTATGTCTTCAACAATGGGCAAATGGACCTTGACAAACTGAAAGAGC
                      ____________________________________________________________
consensus TCATTGTTACATCTTATGTCTTCAACAATGGGCAAATGGACCTTGACAAACTGAAAGAGC
 
. : . : . : . : . : . :
JMFF017F21- TTTCTCAAGTTGTTGGAAAACA
rJMSF049O04+ TTTCTCAAGTTGTTGGAAAACAGAGACTTGTTTTAGATCTTAGTTGCCGCAAAAAGGAGG
rJMFF034G11+ TTTCTCAAGTTGTTGGAAAACAGAGACTTGTTTTAGATCTTAGTTGCCGCAAAAAGGAGG
rJMFF017F21+ TTTCTCAAGTTGTTGGAAAACAGAGACTTGTTTTAGATCTTAGTTGCCGCAAAAAGGAGG
                      ____________________________________________________________
consensus TTTCTCAAGTTGTTGGAAAACAGAGACTTGTTTTAGATCTTAGTTGCCGCAAAAAGGAGG
 
. : . : . : . : . : . :
rJMSF049O04+ GTAAATATGTAATAGTCACAGATAGATGGCAGAAGTTCACTGATGTACATCTAAATCAGG
rJMFF034G11+ GTAAATATGTAATAGTCACAGATAGATGGCAGAAGTTCACTGATGTACATCTAAATCAGG
rJMFF017F21+ GTAAATATGTAATAGTCACAGATAGATGGCAGAAGTTCACTGATGTACATCTAAATCAGG
                      ____________________________________________________________
consensus GTAAATATGTAATAGTCACAGATAGATGGCAGAAGTTCACTGATGTACATCTAAATCAGG
 
. : . : . : . : . : . :
rJMSF049O04+ AAGTACTGGATTTTCTTGCCCAGTATGCTGATGAATTTTTAGTCCATGGAGTTGATGTTG
rJMFF034G11+ AAGTACTGGATTTTCTTGCCCAGTATGCTGATGAATTTTTAGTCCATGGAGTTGATGTTG
rJMFF017F21+ AAGTACTGGATTTTCTTGCCCAGTATGCTGATGAATTTTTAGTCCATGGAGTTGATGTTG
                      ____________________________________________________________
consensus AAGTACTGGATTTTCTTGCCCAGTATGCTGATGAATTTTTAGTCCATGGAGTTGATGTTG
 
. : . : . : . : . : . :
rJMSF049O04+ AAGGAAAAAAGCTGGGAATAGATGAAGAACTCGTGACATTACTTGGCAAGTATTCACCTA
rJMFF034G11+ AAGGAAAAAAGCTGGGAATAGATGAAGAACTCGTGACATTACTTGGCAAGTATTCACCTA
rJMFF017F21+ AAGGAAAAAAGCTGGGAATAGATGAAGAACTCGTGACATTACTTGGCAAGTATTCACCTA
                      ____________________________________________________________
consensus AAGGAAAAAAGCTGGGAATAGATGAAGAACTCGTGACATTACTTGGCAAGTATTCACCTA
 
. : . : . : . : . : . :
rJMSF049O04+ TTCCCGTTACATATGCTGGTGGTGTCACTGTAATGGCTGATTTGGAGAGGATCAAAGTTG
rJMFF034G11+ TTCCCGTTACATATGCTGGTGGTGTCACTGTAATGGCTGATTTGGAGAGGATCAAAGTTG
rJMFF017F21+ TTCCCGTTACATATGCTGGTGGTGTCACTGTAATGGCTGATTTGTAGAGGATCAAAGTTG
                      ____________________________________________________________
consensus TTCCCGTTACATATGCTGGTGGTGTCACTGTAATGGCTGATTTGGAGAGGATCAAAGTTG
 
. : . : . : . : . : . :
rJMSF049O04+ CGGGGATGGGTCGTGTGGATGTTACCGTGGGAAGTGCTCTGGACATATTTGGTGGGAAGT
rJMFF034G11+ CGGGGATGGGTCGTGTGGATGTTACCGTGGGAAGTGCTCTGGACATATTTGGTGGGAAGT
rJMFF017F21+ CGGGGATGGGTCGTGTGGATGTTACCGTGGGAAGTGCTCTGGACATATTTGGTGGGAAGT
                      ____________________________________________________________
consensus CGGGGATGGGTCGTGTGGATGTTACCGTGGGAAGTGCTCTGGACATATTTGGTGGGAAGT
 
. : . : . : . : . : . :
rJMSF049O04+ TGGCATACAAAGATGTCGTGGCTTGGCATGCACAGCAGAACCCCTTAGTGGTTTAATGTC
rJMFF034G11+ TGGCATACAAAGATGTCGTGGCTTGGCATGCACAGCAGAACCCCTTAGTGGTTTAATGTC
rJMFF017F21+ TGGCATACAAAGATGTCGTGGCTTGGCATGCACAGCAGAACCCCTTAGTGGTTTAATGTC
                      ____________________________________________________________
consensus TGGCATACAAAGATGTCGTGGCTTGGCATGCACAGCAGAACCCCTTAGTGGTTTAATGTC
 
. : . : . : . : . : . :
rJMSF049O04+ TCACCTTGGTTCATCCAAATTTTGCATTGTAAGAATAAACCTCAAATTATCCT
rJMFF034G11+ TCACCTTGGTTCATCCAAATTTTGCATTGTAAGAATAAACCTCAAATTATCCTTGTTTGC
rJMFF017F21+ TCACCTTGGTTCATCCAAATTTTGCATTGTAAGAATAAACCTCAAATTATCCTTGTTTGC
                      ____________________________________________________________
consensus TCACCTTGGTTCATCCAAATTTTGCATTGTAAGAATAAACCTCAAATTATCCTTGTTTGC
 
. : . : . : . : . : . :
rJMFF034G11+ TTTGTGATTACTCAAT
rJMFF017F21+ TTTGTGATTACTCAATTGGACTGTTAGTTTGAAGTGTTGTGAACTTTCATTTGTCGTTTT
                      ____________________________________________________________
consensus TTTGTGATTACTCAATTGGACTGTTAGTTTGAAGTGTTGTGAACTTTCATTTGTCGTTTT
 
. : . : . : . : . : . :
rJMFF017F21+ ACCATAGTGCTTGAGGTGGTTGTAAAAACCATAAGTTAGATAAGAATAAAGAATAACAAA
                      ____________________________________________________________
consensus ACCATAGTGCTTGAGGTGGTTGTAAAAACCATAAGTTAGATAAGAATAAAGAATAACAAA