Previous Contig 008997:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D24Sequence600008997 (3)gb:AC136219_17430455e-25Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073E05, complet
JMFF029D14Sequence478014642gb:AF370497_17922822e-10Arabidopsis thaliana unknown protein (At4g01220) mRNA, complete cds.730008997 (3)pir|T01721|T017213e-61hypothetical protein A_IG002N01.8 - Arabidopsis thaliana>gb:IG002N01_1683043 Ara
JMFF030C01Sequence534008997 (3)gb:AC136219_17430452e-38Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073E05, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF029D14+ ACTCTCACGATTTGCCACNTCCAGGGAAAAAAGGCCGA
                      ____________________________________________________________
consensus ACTCTCACGATTTGCCACNTCCAGGGAAAAAAGGCCGA
 
. : . : . : . : . : . :
rJMFF029D14+ ACTTACATATGTAAGCTGCATGATTTATATGCGACCCACAGATGGAGCAAAATTAGTGAT
                      ____________________________________________________________
consensus ACTTACATATGTAAGCTGCATGATTTATATGCGACCCACAGATGGAGCAAAATTAGTGAT
 
. : . : . : . : . : . :
rJMFF030C01+ CAAAGCAAAGAAAGCTAATGA
rJMFF029D14+ GAAGAAGTGGATTGAAGAACTATCGGCTCAACCATGGTCCAAAGCAAAGAAAGCTAATGA
                      ____________________________________________________________
consensus GAAGAAGTGGATTGAAGAACTATCGGCTCAACCATGGTCCAAAGCAAAGAAAGCTAATGA
 
. : . : . : . : . : . :
rJMFF030C01+ CCAGCCTGCTTTTAACTGGGCACTAAACAAAACTGCTGGACAGGTCGACTTGTATCTGNT
rJMFF029D14+ CCAGCCTGCTTTTAACTGGGCACTAAACAAAACTGCTGGACAGGTCGACTTGTATCTGCT
rJMFF017D24+ T
                      ____________________________________________________________
consensus CCAGCCTGCTTTTAACTGGGCACTAAACAAAACTGCTGGACAGGTCGACTTGTATCTGCT
 
. : . : . : . : . : . :
rJMFF030C01+ TCCTCAAGCAGCGTTCCCAACGGGTGGTCTGTACTTCAAGAACCAANCATGGTTGCAAGA
rJMFF029D14+ TCCTCAAGCAGCGTTCCCAACGGGTGGTCTGTACTTCAAGAACCAAACATGGTTGCAAGA
rJMFF017D24+ TCCTCAAGCAGCGTTCCCAACGGGTGGTCTGTACTTCAAGAACCAAACATGGTTGCAAGA
                      ____________________________________________________________
consensus TCCTCAAGCAGCGTTCCCAACGGGTGGTCTGTACTTCAAGAACCAAACATGGTTGCAAGA
 
. : . : . : . : . : . :
rJMFF030C01+ GACCAAGGGAACGACTGTTATTATCCACAATAACTATATTACTGGTTTTGAGAAGAAGAT
rJMFF029D14+ GACCAAGGGAACGACTGTTATTATCCACAATAACTATATTACTGGTTTTGAGAAGAAGAT
rJMFF017D24+ GACCAAGGGAACGACTGTTATTATCCACAATAACTATATTACTGGTTTTGAGAAGAAGAT
                      ____________________________________________________________
consensus GACCAAGGGAACGACTGTTATTATCCACAATAACTATATTACTGGTTTTGAGAAGAAGAT
 
. : . : . : . : . : . :
rJMFF030C01+ AAAGCGTTTCCGCGAATTTGGTNTATGGTTGGTGGAAGATCATGCCTCCGAGTCCCCTCT
rJMFF029D14+ AAAGCGTTTCCGCGAATTTGGTCTATGGTTGGTGGAAGATCATGCCTCCGAGTCCCCTCT
rJMFF017D24+ AAAGCGTTTCCGCGAATTTGGTCTATGGTTGGTGGAAGATCATGCCTCCGAGTCCCCTCT
                      ____________________________________________________________
consensus AAAGCGTTTCCGCGAATTTGGTCTATGGTTGGTGGAAGATCATGCCTCCGAGTCCCCTCT
 
. : . : . : . : . : . :
rJMFF030C01+ TGGCAGATTAGACTAGATCCGATGGCCATTCCCAATCTGGACATGAAACCTCACATTGTA
rJMFF029D14+ TGGCAGATTAGACTAGATCCGATGGCCATTCCCAATCTGGACATGAAACCTCACATTGTA
rJMFF017D24+ TGGCAGATTAGACTAGATCCGATGGCCATTCCCAATCTGGACATGAAACCTCACATTGTA
                      ____________________________________________________________
consensus TGGCAGATTAGACTAGATCCGATGGCCATTCCCAATCTGGACATGAAACCTCACATTGTA
 
. : . : . : . : . : . :
rJMFF030C01+ ATCTCTTCTCGTCAAGCAAAAACACGATTTTGTGGTAAAAGATTTGTAATTCCAGCTGCA
rJMFF029D14+ ATCTCTTCTCGTCAAGCAAAAACACGATTTTGTGGTAAAAGATTTGTAATTCCAGCTGCA
rJMFF017D24+ ATCTCTTCTCGTCAAGCAAAAACACGATTTTGTGGTAAAAGATTTGTAATTCCAGCTGCA
                      ____________________________________________________________
consensus ATCTCTTCTCGTCAAGCAAAAACACGATTTTGTGGTAAAAGATTTGTAATTCCAGCTGCA
 
. : . : . : . : . : . :
rJMFF030C01+ GNTCACTTGTTGCTAGGAAACCCTTGAATTCTAGATGATTATATATAAATATATATAGTT
rJMFF029D14+ GCTCACTTGTTGCTAGGAAACCCTTGAATTCTAGATGATTATATATAAATATATATAGTT
rJMFF017D24+ GCTCACTTGTTGCTAGGAAACCCTTGAATTCTAGATGATTATATATAAATATATATAGTT
                      ____________________________________________________________
consensus GCTCACTTGTTGCTAGGAAACCCTTGAATTCTAGATGATTATATATAAATATATATAGTT
 
. : . : . : . : . : . :
rJMFF030C01+ GCAACAACAGCTCCCAGCCAGATTTGCAGCTGATGAGCTGGAATTTTCTGGCATGTAGAA
rJMFF029D14+ GCAACAACAGCTCCCAGCCAGATTTGCA-CTGATGAGCTGGAATTTTCTGGCATGTAGAA
rJMFF017D24+ GCAACAACAGCTCCCAGCCAGATTTGCA-CTGATGAGCTGGAATTTTCTGGCATGTAGAA
                      ____________________________________________________________
consensus GCAACAACAGCTCCCAGCCAGATTTGCA-CTGATGAGCTGGAATTTTCTGGCATGTAGAA
 
. : . : . : . : . : . :
rJMFF030C01+ GCTAGCGCTGTGAAGCACTCAAGCGCCTGTTAC
rJMFF029D14+ GCTAGCGCTGTGAAGCACTCAAGCGCCTGTTACTCCTTGATTTGTTGTGTATTTCTACCA
rJMFF017D24+ GCTAGCGCTGTGAAGCACTCAAGCGCCTGTTACTCCTTGATTTGTTGTGTATTTCTACCA
                      ____________________________________________________________
consensus GCTAGCGCTGTGAAGCACTCAAGCGCCTGTTACTCCTTGATTTGTTGTGTATTTCTACCA
 
. : . : . : . : . : . :
rJMFF029D14+ TCCTAAAATGTAGTTTTCAAACTGGTTCAAATA
rJMFF017D24+ TCCTAAAATGTAGTTTTCAAACTGGTTCAAATAATTTATTTAGATTTATTATTTAGAAGC
                      ____________________________________________________________
consensus TCCTAAAATGTAGTTTTCAAACTGGTTCAAATAATTTATTTAGATTTATTATTTAGAAGC
 
. : . : . : . : . : . :
rJMFF017D24+ ATTTGTTTTAAGGGTTTCCATGTAATATTTTTTTAGACGCATCAAGAGAATTGATAAGAA
                      ____________________________________________________________
consensus ATTTGTTTTAAGGGTTTCCATGTAATATTTTTTTAGACGCATCAAGAGAATTGATAAGAA