Previous Contig 008996:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D17Sequence554008996 (4)gb:AY088389_15734092e-39Arabidopsis thaliana clone 6401 mRNA, complete sequence.736008996 (4)gb:AY088389_15734091e-49Arabidopsis thaliana clone 6401 mRNA, complete sequence.
JMSF053G11Sequence515008996 (4)gb:AY088389_15734092e-36Arabidopsis thaliana clone 6401 mRNA, complete sequence.942008996 (4)gb:AY088389_15734095e-80Arabidopsis thaliana clone 6401 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017D17- AGTCA
                      ____________________________________________________________
consensus AGTCA
 
. : . : . : . : . : . :
JMFF017D17- CTCATTTTCCCAAAGTCAGTGTACCATTGTGAGTTCAAAGTATTTCTCTGTCAATTTTTT
JMSF053G11- AAAGTATTTCTCTGTCAATTTTTT
                      ____________________________________________________________
consensus CTCATTTTCCCAAAGTCAGTGTACCATTGTGAGTTCAAAGTATTTCTCTGTCAATTTTTT
 
. : . : . : . : . : . :
JMFF017D17- GCGATTCGATTGCCCTACTTGATCCAGATCTGGCCTGAGACAATCTGGGAGCATCCCTTA
JMSF053G11- GCGATTCGATTGCCCTACTTGATCCAGATCTGGCCTGAGACAATCTGGGAGCATCCCTTA
                      ____________________________________________________________
consensus GCGATTCGATTGCCCTACTTGATCCAGATCTGGCCTGAGACAATCTGGGAGCATCCCTTA
 
. : . : . : . : . : . :
JMFF017D17- TTTACCATATTTTTCATATGGAACTCCCGAATTCAACCCAGAATCATGAAGTCAAGCCGC
JMSF053G11- TTTACCATATTTTTCATATGGAACTCCCGAATTCAACCCAGAATCATGAAGTCAAGCCGC
rJMSF053G11+ TCCCGNATTCANCCCAGAATCATGAAGTCAAGCCGC
                      ____________________________________________________________
consensus TTTACCATATTTTTCATATGGAACTCCCGAATTCAACCCAGAATCATGAAGTCAAGCCGC
 
. : . : . : . : . : . :
JMFF017D17- CTAAGAATATATTCATTCTATCGGGCCAAAGCAACATGGCTGGTCGTGGTGGAGTAGACA
JMSF053G11- CTAAGAATATATTCATTCTATCGGGCCAAAGCAACATGGCTGGTCGTGGTGGAGTAGACA
rJMSF053G11+ CTAAGAATATATTCATTCTATCGGGCCAAAGCAACATGGCTGGTCGTGGTGGAGTAGACA
                      ____________________________________________________________
consensus CTAAGAATATATTCATTCTATCGGGCCAAAGCAACATGGCTGGTCGTGGTGGAGTAGACA
 
. : . : . : . : . : . :
JMFF017D17- AGAACAAGAAATGGGATGGCGTAGTTCCTCCTGAATGTAGCCCCGACTCATCCAAAATCT
JMSF053G11- AGAACAAGAAATGGGATGGCGTAGTTCCTCCTGAATGTAGCCCCGACTCATCCAAAATCT
rJMSF053G11+ AGAACAAGAAATGGGATGGCGTAGTTCCTCCTGAATGTAGCCCCGACTCATCCAAAATCT
                      ____________________________________________________________
consensus AGAACAAGAAATGGGATGGCGTAGTTCCTCCTGAATGTAGCCCCGACTCATCCAAAATCT
 
. : . : . : . : . : . :
JMFF017D17- TCCGTCTTAGTGCACAGCTCTGCTGGGAGGTGGCTTGTGAACCACTGCATCATGACATTG
JMSF053G11- TCCGTCTTAGTGCACAGCTCTGCTGGGAGGTGGCTTGTGAACCACTGCATCATGACATTG
rJMSF053G11+ TCCGTCTTAGTGCACAGCTCTGCTGGGAGGTGGCTTGTGAACCACTGCATCATGACATTG
                      ____________________________________________________________
consensus TCCGTCTTAGTGCACAGCTCTGCTGGGAGGTGGCTTGTGAACCACTGCATCATGACATTG
 
. : . : . : . : . : . :
JMFF017D17- ATGCCAAGAAGACCTGTGGTGTTGGACCAGGAATGTCGTTTTCAAATGCGGTAAAGGACA
JMSF053G11- ATGCCAAGAAGACCTGTGGTGTTGGACCAGGAATGTCGTTTTCAAATGCGGTAAAGGACA
rJMSF053G11+ ATGCCAAGAAGACCTGTGGTGTTGGACCAGGAATGTCGTTTTCAAATGCGGTAAAGGACA
rJMFF017D17+ CAAATGCGGTAAAGGACA
                      ____________________________________________________________
consensus ATGCCAAGAAGACCTGTGGTGTTGGACCAGGAATGTCGTTTTCAAATGCGGTAAAGGACA
 
. : . : . : . : . : . :
JMFF017D17- GTGTGGGTGTTTTTGGCCTTGTTCCCTGTGCGGTAGGTGGAACTGCGATAAAGGAGTGGG
JMSF053G11- GTGTGGGTGTTTTTGGCCTTGTTCCCTGTGCGGTAGGTGGAACTGCGATAAAGGANTGGG
rJMSF053G11+ GTGTGGGTGTTTTTGGCCTTGTTCCCTGTGCGGTAGGTGGAACTGCGATAAAGGAGTGGG
rJMFF017D17+ GTGTGGGTGTTTTTGGCCTTGTTCCCTGTGCGGTAGGTGGANCTGCGATAAAGGAGTGGG
                      ____________________________________________________________
consensus GTGTGGGTGTTTTTGGCCTTGTTCCCTGTGCGGTAGGTGGAACTGCGATAAAGGAGTGGG
 
. : . : . : . : . : . :
JMFF017D17- CACGCGGGGAACATTTGTATGAGAACATGGTGAAGAGAGCGAAATCTGCCATTC
JMSF053G11- CACGCGGGGAACATTTGTATGANAACATGGTGAANANAGCGAAATCTGCCATTC
rJMSF053G11+ CACGCGGGGAACATTTGTATGAGAACATGGTGAAGAGAGCGAAATCTGCCATTCGTGATG
rJMFF017D17+ CACGCGGGGAACATTTGTATGAGAACATGGTGAAGAGAGCGAAATNTGCCATTCGTGATG
                      ____________________________________________________________
consensus CACGCGGGGAACATTTGTATGAGAACATGGTGAAGAGAGCGAAATCTGCCATTCGTGATG
 
. : . : . : . : . : . :
rJMSF053G11+ GCGGTTGCGAGATCAAGGCATTGCTGTGGTACCAGGGTGAGAGTGATACATCATCAAAAC
rJMFF017D17+ GCGGTTGCGAGATCAAGGCATTGCTGTGGTACCAGGGTGAGAGTGATACATCATCAAAAC
                      ____________________________________________________________
consensus GCGGTTGCGAGATCAAGGCATTGCTGTGGTACCAGGGTGAGAGTGATACATCATCAAAAC
 
. : . : . : . : . : . :
rJMSF053G11+ ATGATGCCGAGAGTTACAGAGCTAATATGGAAACACTAATACACAACATCCGCAACGATT
rJMFF017D17+ ATGATGCCGAGAGTTACAGAGCTAATATGGAAACACTAATACACAACATCCGCAACGATT
                      ____________________________________________________________
consensus ATGATGCCGAGAGTTACAGAGCTAATATGGAAACACTAATACACAACATCCGCAACGATT
 
. : . : . : . : . : . :
rJMSF053G11+ TGGATTTGCCAACTCTGCCAATTATTCAGGTTGCTATTGCATCAGGGGATAAAAAATACA
rJMFF017D17+ TGGATTTGCCAACTCTGCCAATTATTCAGGTTGCTATTGCATCAGGGGATAAAAAATACA
                      ____________________________________________________________
consensus TGGATTTGCCAACTCTGCCAATTATTCAGGTTGCTATTGCATCAGGGGATAAAAAATACA
 
. : . : . : . : . : . :
rJMSF053G11+ TTGAGGAAGTAAGAAAAGCGCAAAAGGAAATTGACCTTCCAAATGTCGTGTGCATTGATG
rJMFF017D17+ TTGAGGAAGTAAGAAAAGCGCAAAAGGAAATTGACCTTCCAAATGTCGTGTGCATTGATG
                      ____________________________________________________________
consensus TTGAGGAAGTAAGAAAAGCGCAAAAGGAAATTGACCTTCCAAATGTCGTGTGCATTGATG
 
. : . : . : . : . : . :
rJMSF053G11+ CCTGGGGATTGGAGCTCAAGGAAGATAATCTCCATTTGACCACAGAAGCCCAGGTTCAAC
rJMFF017D17+ CCTGGGGATTGGAGCTCAAGGAAGATAATCTCCATTTGACCACAGAAGCCCAGGTTCAAC
                      ____________________________________________________________
consensus CCTGGGGATTGGAGCTCAAGGAAGATAATCTCCATTTGACCACAGAAGCCCAGGTTCAAC
 
. : . : . : . : . : . :
rJMSF053G11+ TTGGCCAAATGCTTGCAGAAGCATATCTTACCCGGTTTGCGTCAAACGTTCCTTCTACTG
rJMFF017D17+ TTGGCCAAATGCTTGCAGAAGCATATCTTACCCGGTTTGCGTCAAACGTTCCTTTTACTG
                      ____________________________________________________________
consensus TTGGCCAAATGCTTGCAGAAGCATATCTTACCCGGTTTGCGTCAAACGTTCCTTTTACTG
 
. : . : . : . : . : . :
rJMSF053G11+ CTCTTTAAGCCATGGAGTGTTCTTATTAGCTTTGGAGTCTCTGAATGTGAATGTGTGAAA
rJMFF017D17+ CTCTTTAAGCCATGGAGTGTTCTTATTAGCTTTGGAGTCTCTGAATGTGAATGTGNGANA
                      ____________________________________________________________
consensus CTCTTTAAGCCATGGAGTGTTCTTATTAGCTTTGGAGTCTCTGAATGTGAATGTGTGAAA
 
. : . : . : . : . : . :
rJMSF053G11+ AACATTCTAGCACTTATTCTACTGTTCAGAACAAGGGAGAAATCATTGTTTGGATATGCA
rJMFF017D17+ AACATTCTAGCACTTATTCTACTGTTCAGAACAAGGGAGAAATCATTGTTTGGATATGCA
                      ____________________________________________________________
consensus AACATTCTAGCACTTATTCTACTGTTCAGAACAAGGGAGAAATCATTGTTTGGATATGCA
 
. : . : . : . : . : . :
rJMSF053G11+ TTTGTGATAGAATAGCTCTGATCCGATCCTCTCCACGATGATCTTTTGGACCTATAATTC
rJMFF017D17+ TTTGTGATAGAATAGCTNTGATCCGATCCTCT-CNCGATGATCTTTTGGA-CTATAATTC
                      ____________________________________________________________
consensus TTTGTGATAGAATAGCTCTGATCCGATCCTCTCCACGATGATCTTTTGGACCTATAATTC
 
. : . : . : . : . : . :
rJMSF053G11+ ATCATT
rJMFF017D17+ ATCATTTTAACAATATTTGTTGATGGTGGTGACTAGATCTTTATTTGTTGTTTGATCCTC
                      ____________________________________________________________
consensus ATCATTTTAACAATATTTGTTGATGGTGGTGACTAGATCTTTATTTGTTGTTTGATCCTC