Previous Contig 008993:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017D05Sequence506008993 (2)gb:AB005238_15094223e-31Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MKP11.>gb:AY035119_1559791008993 (2)gb:AP005504_18530056e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P057

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017D05- GATTTGCC
                      ____________________________________________________________
consensus GATTTGCC
 
. : . : . : . : . : . :
JMFF017D05- ACCATCCAATTACTTGTGAACATGTCATCAACGGTGGTCGCCGCCGGCACCTCCTCCGCC
                      ____________________________________________________________
consensus ACCATCCAATTACTTGTGAACATGTCATCAACGGTGGTCGCCGCCGGCACCTCCTCCGCC
 
. : . : . : . : . : . :
JMFF017D05- GCCTACTCCCGAGGCAGATCAGTCAACAGAGCCACTCCCTCCGCTCCCCAATGCCAGAAA
                      ____________________________________________________________
consensus GCCTACTCCCGAGGCAGATCAGTCAACAGAGCCACTCCCTCCGCTCCCCAATGCCAGAAA
 
. : . : . : . : . : . :
JMFF017D05- ACTAGTTTTCAAGGGGTATCACTTCAAGACTCGAGAAGGGGCATCTCCAATTTGTTCTTG
                      ____________________________________________________________
consensus ACTAGTTTTCAAGGGGTATCACTTCAAGACTCGAGAAGGGGCATCTCCAATTTGTTCTTG
 
. : . : . : . : . : . :
JMFF017D05- GCTGAGAAGGGTGTTAGTTTGAGCGTTACAAGAGGAAGAAGAGACCTTGTGATCACTGCA
rJMFF017D05+ GTGATCACTGCA
                      ____________________________________________________________
consensus GCTGAGAAGGGTGTTAGTTTGAGCGTTACAAGAGGAAGAAGAGACCTTGTGATCACTGCA
 
. : . : . : . : . : . :
JMFF017D05- AGAACTGCTGCCAAGAACATTGAGGTTGAAGTTGACAAGCCATTGGGACTCACTCTTGGT
rJMFF017D05+ AGAACTGCTGCCAAGAACATTGAGGTNGAAGTTGACAAGCCATTGGGACTCACTCTTGGT
                      ____________________________________________________________
consensus AGAACTGCTGCCAAGAACATTGAGGTTGAAGTTGACAAGCCATTGGGACTCACTCTTGGT
 
. : . : . : . : . : . :
JMFF017D05- CAAAAATCTGGTGGGTGGGGTTGTCATTACTGCTGTGGAAAATGGTGGAAATGCTGCCAA
rJMFF017D05+ CAAAAATCTGGT-GGTGGGGTTGTCATTACTGCTGTGGAAAATGGTGGAAATGCTGCCAA
                      ____________________________________________________________
consensus CAAAAATCTGGTGGGTGGGGTTGTCATTACTGCTGTGGAAAATGGTGGAAATGCTGCCAA
 
. : . : . : . : . : . :
JMFF017D05- AGCAGGGCTCAAGGCTGGTGACCAAGTGATCTACACCAGCAGCTTTTTTGGAGATGAACT
rJMFF017D05+ AGCAGGGCTCAAGGCTGGTGACCAAGTGATCTACACCAGCAGCTTTTTTGGAGATGAACT
                      ____________________________________________________________
consensus AGCAGGGCTCAAGGCTGGTGACCAAGTGATCTACACCAGCAGCTTTTTTGGAGATGAACT
 
. : . : . : . : . : . :
JMFF017D05- TTGGCCAGCTGACAAGCTCGGGTTTACAAAGACAGCAATCCAGGCTGTGCCCGAATCTGT
rJMFF017D05+ TTGGCCAGCTGACAAGCTCGGGTTTACAAAGACAGCAATCCAGGCTGTGCCCGAATCTGT
                      ____________________________________________________________
consensus TTGGCCAGCTGACAAGCTCGGGTTTACAAAGACAGCAATCCAGGCTGTGCCCGAATCTGT
 
. : . : . : . : . : . :
JMFF017D05- GTACTTCGTTGTTAGCAG
rJMFF017D05+ GTACTTCGTTGTTAGCAGGGGAGTTGATGTAGATGTTAAAAGACTGCCAAAGCGTCCGGC
                      ____________________________________________________________
consensus GTACTTCGTTGTTAGCAGGGGAGTTGATGTAGATGTTAAAAGACTGCCAAAGCGTCCGGC
 
. : . : . : . : . : . :
rJMFF017D05+ TCCTCCTCGCTTTGGAAGGAAATTAACTGATGCTCAAAAGGCCCGAGCAACGCACATATG
                      ____________________________________________________________
consensus TCCTCCTCGCTTTGGAAGGAAATTAACTGATGCTCAAAAGGCCCGAGCAACGCACATATG
 
. : . : . : . : . : . :
rJMFF017D05+ CCTTGATTGTGGATACATCTACACGTTGCAGAAGCCTTTCGAAGAGCAGCCGGATGGTTA
                      ____________________________________________________________
consensus CCTTGATTGTGGATACATCTACACGTTGCAGAAGCCTTTCGAAGAGCAGCCGGATGGTTA
 
. : . : . : . : . : . :
rJMFF017D05+ CGTATGTCCCCAATGCAGGGCGCCAAAGAAGAGGTTTTTACCGTATGATGTCAACACTGG
                      ____________________________________________________________
consensus CGTATGTCCCCAATGCAGGGCGCCAAAGAAGAGGTTTTTACCGTATGATGTCAACACTGG
 
. : . : . : . : . : . :
rJMFF017D05+ AAAAGCGGTTGGCGGAGGGCTGCCTCCCATCGGAGTCATCATCGGGCTTTTAGTTGGGAT
                      ____________________________________________________________
consensus AAAAGCGGTTGGCGGAGGGCTGCCTCCCATCGGAGTCATCATCGGGCTTTTAGTTGGGAT
 
. : . : . : . : . : . :
rJMFF017D05+ CGGTGGTGTTGGAGCTCTGCTAGTTTATGGACTTCAATGAAGAAAAACCAGAGAAGAAAT
                      ____________________________________________________________
consensus CGGTGGTGTTGGAGCTCTGCTAGTTTATGGACTTCAATGAAGAAAAACCAGAGAAGAAAT
 
. : . : . : . : . : . :
rJMFF017D05+ CCTATGTTCAAAATATTCCACCTCATTCTTAATCTTCATATCCAATGTATGTGTTCTTAG
                      ____________________________________________________________
consensus CCTATGTTCAAAATATTCCACCTCATTCTTAATCTTCATATCCAATGTATGTGTTCTTAG
 
. : . : . : . : . : . :
rJMFF017D05+ AAATGCATATATGTTGCAAAGGCTAATGTTGACAAGAGCCTGTCTTTTATGTAGTGAAAG
                      ____________________________________________________________
consensus AAATGCATATATGTTGCAAAGGCTAATGTTGACAAGAGCCTGTCTTTTATGTAGTGAAAG
 
. : . : . : . : . : . :
rJMFF017D05+ AGTGAATATGAACTGTTTAATGGCAATTACTCTCAAAGTGTACTTATCATCAACCTAAGT
                      ____________________________________________________________
consensus AGTGAATATGAACTGTTTAATGGCAATTACTCTCAAAGTGTACTTATCATCAACCTAAGT