Previous Contig 008992:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017C22Sequence613008992 (4)gb:AY062669_15653255e-82Arabidopsis thaliana putative protein (At4g12790; T20K18.140) mRNA, complete cds819008992 (4)gb:AC090882_17345784e-83Oryza sativa chromosome 3 BAC OSJNBa0014G15 genomic sequence, complete sequence.
JMSF027I09Sequence653008992 (4)gb:AC090882_17345786e-47Oryza sativa chromosome 3 BAC OSJNBa0014G15 genomic sequence, complete sequence.732008992 (4)gb:AC090882_17345781e-85Oryza sativa chromosome 3 BAC OSJNBa0014G15 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF027I09- GGTCTTGCGCTGTCGCCGGCT
                      ____________________________________________________________
consensus GGTCTTGCGCTGTCGCCGGCT
 
. : . : . : . : . : . :
JMSF027I09- CTGTCTCCACTGGGAACTGGCCCTGTGACGCCGGCGATTCTCCGTCTCATCGCATCCTCA
                      ____________________________________________________________
consensus CTGTCTCCACTGGGAACTGGCCCTGTGACGCCGGCGATTCTCCGTCTCATCGCATCCTCA
 
. : . : . : . : . : . :
JMSF027I09- GCTAGTCGGATCCTCCGTACTCCTCCGTCTGCTCAGCGGCTCGTCGCCTCCAACCCTCTG
                      ____________________________________________________________
consensus GCTAGTCGGATCCTCCGTACTCCTCCGTCTGCTCAGCGGCTCGTCGCCTCCAACCCTCTG
 
. : . : . : . : . : . :
JMSF027I09- CTCGGTCCGCTCCAGCCTCCAGTACTCCGCGATTGAGCCGTGAGCGAGTCCTGAGTCCGC
                      ____________________________________________________________
consensus CTCGGTCCGCTCCAGCCTCCAGTACTCCGCGATTGAGCCGTGAGCGAGTCCTGAGTCCGC
 
. : . : . : . : . : . :
JMSF027I09- GTCTCCACCGGCCCCTCTAGCGACGCCCGGTGACCCCACCGCTCCAATCCTCCGTCATTC
                      ____________________________________________________________
consensus GTCTCCACCGGCCCCTCTAGCGACGCCCGGTGACCCCACCGCTCCAATCCTCCGTCATTC
 
. : . : . : . : . : . :
JMSF027I09- CACTCTCCTCGGCTCCTGCTGACTGCCTCACTGCCCAGAGTTCAGCAAAGACATAAGATT
JMFF017C22- GCAAAGACATAAGATT
                      ____________________________________________________________
consensus CACTCTCCTCGGCTCCTGCTGACTGCCTCACTGCCCAGAGTTCAGCAAAGACATAAGATT
 
. : . : . : . : . : . :
JMSF027I09- AAGGAGAATGGGCTATGCACAGCTGGTTATTGGCCCTGCAGGCAGTGGAAAGTCAACTTA
JMFF017C22- AAGGAGAATGGGCTACGCACAGCTGGTTACTGGCCCTGCAGGCAGTGGAAAGTCAACTTA
                      ____________________________________________________________
consensus AAGGAGAATGGGCTATGCACAGCTGGTTATTGGCCCTGCAGGCAGTGGAAAGTCAACTTA
 
. : . : . : . : . : . :
JMSF027I09- CTGCTCAAATTTGCATCGACATTGTGAAGCCACACGACGAACAATCCATATAGTGAACTT
JMFF017C22- CTGCTCAAATTTGCATCGACATTGTGAAGCCACACGACGAACAATCCATATAGTGAACTT
                      ____________________________________________________________
consensus CTGCTCAAATTTGCATCGACATTGTGAAGCCACACGACGAACAATCCATATAGTGAACTT
 
. : . : . : . : . : . :
JMSF027I09- AGATCCTGCAGCAGAGAATTTTGACTATCCAGTGGCTATGGACATCAGGGAACTGATTTC
JMFF017C22- AGATCCTGCAGCAGAGAATTTTGACTATCCAGTGGCTATGGACATCAGGGAACTGATTTC
                      ____________________________________________________________
consensus AGATCCTGCAGCAGAGAATTTTGACTATCCAGTGGCTATGGACATCAGGGAACTGATTTC
 
. : . : . : . : . : . :
JMSF027I09- GCTGGATGATGTTATGGAGGAACTACATCTAGGCCCTAATGGTGGCCTTATTTATTGCAT
JMFF017C22- ACTGGATGATGTTATGGAGGAACTACATCTAGGCCCTAATGGTGGCCTCATTTATTGCAT
                      ____________________________________________________________
consensus GCTGGATGATGTTATGGAGGAACTACATCTAGGCCCTAATGGTGGCCTTATTTATTGCAT
 
. : . : . : . : . : . :
JMSF027I09- GGAACACCTTGAAGAAAATTTGGATGACTGGCTAACAGAGGAGTTGGATAATTATATGGA
JMFF017C22- GGAACACCTTGAAGAAAATTTGGATGACTGGCTAACAGAGGAATTGGATAATTATATGGA
rJMSF027I09+ GGATGACTGGCTAACAGAGGAGTTGGATAATTATATGGA
rJMFF017C22+ GGATGACTGGCTAACAGAGGAATTGGATAATTATATGGA
                      ____________________________________________________________
consensus GGAACACCTTGAAGAAAATTTGGATGACTGGCTAACAGAGGAGTTGGATAATTATATGGA
 
. : . : . : . : . : . :
JMSF027I09- TGATGACTACCTAGTTTTTGACTGCCCAGGTC
JMFF017C22- TGATGACTACATAGTTTTTGACTGTCCAGGTCAAATTGAACTCTTCTCACATGTTCCTGT
rJMSF027I09+ TGATGACTACCTAGTTTTTGACTGCCCAGGTCAAATTGAACTCTTCTCACATGTTCCTGT
rJMFF017C22+ TGATGACTACATAGTTTTTGACTGTCCAGGTCAAATTGAACTCTTCTCACATGTTCCTGT
                      ____________________________________________________________
consensus TGATGACTACCTAGTTTTTGACTGTCCAGGTCAAATTGAACTCTTCTCACATGTTCCTGT
 
. : . : . : . : . : . :
JMFF017C22- GCTAAAGAATTTTGTGGAACATTTAAAGCGAAAGAATTTCAATGTCTGTGTAGTTTACTT
rJMSF027I09+ GCTGAAGAATTTTGTGGAACACTTAAAGCGAAAGAATTTCAATATCTGCGTAGTTTACTT
rJMFF017C22+ GCTAAAGAATTTTGTGGAACATTTAAAGCGAAAGAATTTCAATGTCTGTGTAGTTTACTT
                      ____________________________________________________________
consensus GCTAAAGAATTTTGTGGAACATTTAAAGCGAAAGAATTTCAATGTCTGTGTAGTTTACTT
 
. : . : . : . : . : . :
JMFF017C22- ACTTGATTCTCAGTTTATCACGGATGTGGCCAAATTCATCAGTGGTTGTATGGCTTCCCT
rJMSF027I09+ ACTTGATTCTCAGTTTATCACGGATGTGACCAAATTCATTAGTGGTTGTATGGCTTCCCT
rJMFF017C22+ ACTTGATTCTCAGTTTATCACGGATGTGGCCAAATTCATCAGTGGTTGTATGGCTTCCCT
                      ____________________________________________________________
consensus ACTTGATTCTCAGTTTATCACGGATGTGGCCAAATTCATCAGTGGTTGTATGGCTTCCCT
 
. : . : . : . : . : . :
JMFF017C22- CTCTGCAATGGTTCAACTTGAATTGCCACATGTCAACATTCTCTCAAA
rJMSF027I09+ CTCTGCAATGGTTCAACTTGAATTGCCTCATGTCAACATTCTCTCAAAAATGGACCTTGT
rJMFF017C22+ CTCTGCAATGGTTCAACTTGAATTGCCACATGTCAACATTCTCTCAAAAATGGACCTTGT
                      ____________________________________________________________
consensus CTCTGCAATGGTTCAACTTGAATTGCCACATGTCAACATTCTCTCAAAAATGGACCTTGT
 
. : . : . : . : . : . :
rJMSF027I09+ GACAAATAAAAAGGATATTGACAATTACTTGAATCCAGAGCCTCACTTGCTATTGGCAGA
rJMFF017C22+ GACAAATAAAAAGGATATTGACAATTACTTGAATTCAGAGGCTCAGTTGCTATTGGCGGA
                      ____________________________________________________________
consensus GACAAATAAAAAGGATATTGACAATTACTTGAATTCAGAGGCTCAGTTGCTATTGGCGGA
 
. : . : . : . : . : . :
rJMSF027I09+ TTTGAATCAGCGCATGGCTCCACAATTTCAAAAGCTTAACAAATCTTTAATTGAGTTGGT
rJMFF017C22+ TCTGAATCAACGCATGGCTCCACAGTTTCAAAAGCTTAACAAATCTTTAATTGAATTGGT
                      ____________________________________________________________
consensus TTTGAATCAGCGCATGGCTCCACAGTTTCAAAAGCTTAACAAATCTTTAATTGAGTTGGT
 
. : . : . : . : . : . :
rJMSF027I09+ GGATCAGTTTAGTATGGTCAGCTTTATGCCGCTTGATTTGAGGAAAGAGAGCAGTATACA
rJMFF017C22+ GGATCAGTATAGTATGGTCAGCTTTATGCCGCTTGATTTGAGGAAAGAGAGCAGTATACA
                      ____________________________________________________________
consensus GGATCAGTTTAGTATGGTCAGCTTTATGCCGCTTGATTTGAGGAAAGAGAGCAGTATACA
 
. : . : . : . : . : . :
rJMSF027I09+ ATACATCCTGTCACAGATTGACAACTGCATTCAGTATGGTGAGGATGCAGATGTGAAGGT
rJMFF017C22+ ATACATCCTGGCACAGATTGACAACTGCATTCAGTATGGTGAGGATGCAGATGTGAAGGT
                      ____________________________________________________________
consensus ATACATCCTGTCACAGATTGACAACTGCATTCAGTATGGTGAGGATGCAGATGTGAAGGT
 
. : . : . : . : . : . :
rJMSF027I09+ CAAAGATTTCGACAACGAGGAGGATGATT-AAACCTT-CATGTTTTTGGCGGTTTCGGAG
rJMFF017C22+ CAAAGATTTCGCTGCTGAGGAGGATGATTAAAACCTTCCAAGTTTTTGGCGGTTTCGGAG
                      ____________________________________________________________
consensus CAAAGATTTCGCTGCTGAGGAGGATGATTAAAACCTTCCATGTTTTTGGCGGTTTCGGAG
 
. : . : . : . : . : . :
rJMSF027I09+ AAGTTAAAAATGCTTTTT
rJMFF017C22+ AAGCTAAAAACGCTTTTTGAAGCCATTGGGTGGCAACCCTAGTGAAAGATGAACTACCGG
                      ____________________________________________________________
consensus AAGTTAAAAATGCTTTTTGAAGCCATTGGGTGGCAACCCTAGTGAAAGATGAACTACCGG
 
. : . : . : . : . : . :
rJMFF017C22+ TTTTGCAACTTTGTATCCAAGTGTTGTTATTTGTTGTTGAATTTGGAAGATGGAATGGCC
                      ____________________________________________________________
consensus TTTTGCAACTTTGTATCCAAGTGTTGTTATTTGTTGTTGAATTTGGAAGATGGAATGGCC
 
. : . : . : . : . : . :
rJMFF017C22+ TGGCGGGTGGAGAATAAAACCATCCGCCAGTTAGGCGGAAGCAATAATGAAGAATCAAGG
                      ____________________________________________________________
consensus TGGCGGGTGGAGAATAAAACCATCCGCCAGTTAGGCGGAAGCAATAATGAAGAATCAAGG
 
. : . : . : . : . : . :
rJMFF017C22+ AATGGGAAATGTATAGATAATGTATTATCTATCTGTGTTTCTAACAAAAAAACATCAAAC
                      ____________________________________________________________
consensus AATGGGAAATGTATAGATAATGTATTATCTATCTGTGTTTCTAACAAAAAAACATCAAAC