Previous Contig 008988:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017B13Sequence590008988 (2)gb:AP005529_18535682e-48Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P070671008988 (2)gb:AY088581_15735983e-51Arabidopsis thaliana clone 8095 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017B13- GGGTTTCGTAAAGTCTGTAACTTGGTC
                      ____________________________________________________________
consensus GGGTTTCGTAAAGTCTGTAACTTGGTC
 
. : . : . : . : . : . :
JMFF017B13- GGCCTTAACTTCGTCAAACCCATCGGTTTCTAGAATTCAACTCGTCTTTTGCTGTCCGAG
                      ____________________________________________________________
consensus GGCCTTAACTTCGTCAAACCCATCGGTTTCTAGAATTCAACTCGTCTTTTGCTGTCCGAG
 
. : . : . : . : . : . :
JMFF017B13- AATCCGAAATGGTCAGAATGCTCTCGTCGGAGTTCTGGGTCGCCGTGGCTGCGGCGCTGC
rJMFF017B13+ TGCGGCGCTGC
                      ____________________________________________________________
consensus AATCCGAAATGGTCAGAATGCTCTCGTCGGAGTTCTGGGTCGCCGTGGCTGCGGCGCTGC
 
. : . : . : . : . : . :
JMFF017B13- TGGTTTGGAGCGCCGGAGGAGCCTACGGGATCAGATTCGTCATAGACAGAGAGGAGTGCT
rJMFF017B13+ TGGTTTGGAGCGCCGGAGGAGCCTACGGGATCAGATTCGTCATAGACAGAGAGGAGTGCT
                      ____________________________________________________________
consensus TGGTTTGGAGCGCCGGAGGAGCCTACGGGATCAGATTCGTCATAGACAGAGAGGAGTGCT
 
. : . : . : . : . : . :
JMFF017B13- TTTCGCACAAGGTGGAATTGGGGGAAACTGTGCATTTCTCGTTCGTGGTTATTAAATCCG
rJMFF017B13+ TTTCGCACAAGGTGGAATTGGGGGAAACTGTGCATTTCCCGTTCGTGGTTATTAAATCCG
                      ____________________________________________________________
consensus TTTCGCACAAGGTGGAATTGGGGGAAACTGTGCATTTCTCGTTCGTGGTTATTAAATCCG
 
. : . : . : . : . : . :
JMFF017B13- AGAATTCTTGGCATTACAGTGAAGAGGGTGTTGATCTTGTGGTGAAAGGGCCGTCTGGTG
rJMFF017B13+ AGAATTNTTGGCATTACAGTGAAGAGGGTGTTGATCTTGTGGTGAAAGGGCCGTNTGGTG
                      ____________________________________________________________
consensus AGAATTCTTGGCATTACAGTGAAGAGGGTGTTGATCTTGTGGTGAAAGGGCCGTCTGGTG
 
. : . : . : . : . : . :
JMFF017B13- AACAAATTCAAGACTTCCGTGATAAAACAAGCGAGAAATCTGAGTTTATTGCCCATCATG
rJMFF017B13+ AACAAATTCAAGACTTCCGTGATAAAACAAGCGAGAAATNTGAGTTTATTGCCCATCATG
                      ____________________________________________________________
consensus AACAAATTCAAGACTTCCGTGATAAAACAAGCGAGAAATCTGAGTTTATTGCCCATCATG
 
. : . : . : . : . : . :
JMFF017B13- ATGAACATTTGACGCCTTTGTTTGAACACATTGGAAAGCTTGAGGAGGCTTTGTATAACA
rJMFF017B13+ ATGAACATTTGACGCCTTTGTTTGAACACATTGGAAAGCTTGAGGAGGCTTTGTATAACA
                      ____________________________________________________________
consensus ATGAACATTTGACGCCTTTGTTTGAACACATTGGAAAGCTTGAGGAGGCTTTGTATAACA
 
. : . : . : . : . : . :
JMFF017B13- TTCAGTTTGAGCAACACTGGTTGGAGGCTCAGACAGACCGGCAAGCAATAGTAAATGAAG
rJMFF017B13+ TTCAGTTTGAGCAACCCTGGTTGGAGGCTCAGACAGACCGGCAAGCAATAGTAAATGAAG
                      ____________________________________________________________
consensus TTCAGTTTGAGCAACCCTGGTTGGAGGCTCAGACAGACCGGCAAGCAATAGTAAATGAAG
 
. : . : . : . : . : . :
JMFF017B13- GAATGGGCAGAAGAGCAATCTACAAAGCTTTTTGCGAGTCTCTAGCTCTTGTTGCTGCTA
rJMFF017B13+ GAATGGGCAGAAGAGCAATNTACAAAGCTTTTTGCGAGTCTNTAGCTNTTGTTGCTGCTA
                      ____________________________________________________________
consensus GAATGGGCAGAAGAGCAATCTACAAAGCTTTTTGCGAGTCTCTAGCTCTTGTTGCTGCTA
 
. : . : . : . : . : . :
JMFF017B13- GTATTCTGCAAGTTTATCTCCTG
rJMFF017B13+ GTATTNTGCAAGTTTATCTCCTGAAGCATTTGTTTGAGCGGAAGCTGGGGCAGTCCAGAG
                      ____________________________________________________________
consensus GTATTCTGCAAGTTTATCTCCTGAAGCATTTGTTTGAGCGGAAGCTGGGGCAGTCCAGAG
 
. : . : . : . : . : . :
rJMFF017B13+ TTTAGTCTTTGGCCAATNTGATGAAGAAAGTCCAAACAAATTTTTTTTTTTAAAATTTTA
                      ____________________________________________________________
consensus TTTAGTCTTTGGCCAATNTGATGAAGAAAGTCCAAACAAATTTTTTTTTTTAAAATTTTA
 
. : . : . : . : . : . :
rJMFF017B13+ TACAAGTACAAACAATTTCCCAACACCAAGCCAAAATGAGAACTGTTTTCATTAATTTAA
                      ____________________________________________________________
consensus TACAAGTACAAACAATTTCCCAACACCAAGCCAAAATGAGAACTGTTTTCATTAATTTAA
 
. : . : . : . : . : . :
rJMFF017B13+ TTAGGAAGTTAGGCCTTGATATGTTGTATAACAAAAATAATTTATCATAGGATCTCCAAA
                      ____________________________________________________________
consensus TTAGGAAGTTAGGCCTTGATATGTTGTATAACAAAAATAATTTATCATAGGATCTCCAAA