Previous Contig 008981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016P22Sequence746008981 (2)pir|T01617|T016171e-70probable protein kinase [imported] - Arabidopsis thaliana>gb:AC003673_1531156 Ar
JMFF039J15Sequence211014863292008981 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016P22+ AGNTGGAGCTGCTAGAGGTCTGCATT
                      ____________________________________________________________
consensus AGNTGGAGCTGCTAGAGGTCTGCATT
 
. : . : . : . : . : . :
rJMFF016P22+ ATTTACACAAAACCTGTCCCCGAAGAATTATCCATAGAGATATCAAAGCTTCAAATATTT
                      ____________________________________________________________
consensus ATTTACACAAAACCTGTCCCCGAAGAATTATCCATAGAGATATCAAAGCTTCAAATATTT
 
. : . : . : . : . : . :
rJMFF016P22+ TGTTAAGTGAAGAGTTTGAACCACAGATTTCGGATTTTGGACTGGCGAAATGGCTTCCAT
                      ____________________________________________________________
consensus TGTTAAGTGAAGAGTTTGAACCACAGATTTCGGATTTTGGACTGGCGAAATGGCTTCCAT
 
. : . : . : . : . : . :
rJMFF016P22+ CACAANGGACCCATCATTCTATAGCTCCTATAGAAGGGACATNTGGACATCTAGCGCCAG
                      ____________________________________________________________
consensus CACAANGGACCCATCATTCTATAGCTCCTATAGAAGGGACATNTGGACATCTAGCGCCAG
 
. : . : . : . : . : . :
rJMFF016P22+ AGTATTTCATGCATGGAGTGGTGGATGAAAAGACAGATGTTTTTGCATNNGGAGTCTTTC
                      ____________________________________________________________
consensus AGTATTTCATGCATGGAGTGGTGGATGAAAAGACAGATGTTTTTGCATNNGGAGTCTTTC
 
. : . : . : . : . : . :
rJMFF016P22+ TTTTAGAACTCATCTNTGGGAGAAAACCTNTTGATAGCTCTTATCAAAGCCTNCATAGCT
                      ____________________________________________________________
consensus TTTTAGAACTCATCTNTGGGAGAAAACCTNTTGATAGCTCTTATCAAAGCCTNCATAGCT
 
. : . : . : . : . : . :
rJMFF016P22+ GGGCAAAACCTATACTTTTGCAAGGTGAGATAGAAGTGGTTATAGATCCAAGACTTAATG
                      ____________________________________________________________
consensus GGGCAAAACCTATACTTTTGCAAGGTGAGATAGAAGTGGTTATAGATCCAAGACTTAATG
 
. : . : . : . : . : . :
rJMFF039J15+ GTT
rJMFF016P22+ GGAAGTTTGATGTTAAACAACTTGACAANCTTGCCTNTGCCGCATCTCTTTGCATTCGTT
                      ____________________________________________________________
consensus GGAAGTTTGATGTTAAACAACTTGACAANCTTGCCTNTGCCGCATCTCTTTGCATTCGTT
 
. : . : . : . : . : . :
rJMFF039J15+ CTTCTTCCATNNGGCGTCCTACTATCACNGAGGTANTGGAGGTAATCTTGAGGGGGGAGC
rJMFF016P22+ CTTCTTCCATNTGGCGTCCTNCTATCACNGAGGTATTGGAGGTAATCTTGAGGGGGGAGC
                      ____________________________________________________________
consensus CTTCTTCCATNTGGCGTCCTACTATCACNGAGGTATTGGAGGTAATCTTGAGGGGGGAGC
 
. : . : . : . : . : . :
rJMFF039J15+ TTGATAAGGAAAAATGGAAAATGCCAAAAGAAGAAGAAGAGCAAGAAGAGTTTTGGGGGT
rJMFF016P22+ TTGATAAGGAAAAATGGAAAATGCCAAAAGAAGAAGAAGAGCAAGAAGAGTTTTGGGGGT
                      ____________________________________________________________
consensus TTGATAAGGAAAAATGGAAAATGCCAAAAGAAGAAGAAGAGCAAGAAGAGTTTTGGGGGT
 
. : . : . : . : . : . :
rJMFF039J15+ TTGAAGATCTTGAATGTGAATGTGAATGCGATAGCTCTTTCTCAACCTCTCCGCAAAATA
rJMFF016P22+ TTGAAGATCTTGAATGTGAATGTGAATGCGATAGCTCTTTCTCAACCTCTCCGCAAAATA
                      ____________________________________________________________
consensus TTGAAGATCTTGAATGTGAATGTGAATGCGATAGCTCTTTCTCAACCTCTCCGCAAAATA
 
. : . : . : . : . : . :
rJMFF039J15+ CCTTCTCCGCAACCATCTCATANTTAGCAAGATTTAAAATCTTAAATACTCAACTTATTG
rJMFF016P22+ CCTTCTCCGCAACCATCTCATAGTTAGCAAGATTTAAAATCTTAAATACTCAACTTATTG
                      ____________________________________________________________
consensus CCTTCTCCGCAACCATCTCATAGTTAGCAAGATTTAAAATCTTAAATACTCAACTTATTG
 
. : . : . : . : . : . :
rJMFF039J15+ TAAATAATATTAAAAATGTAGTCCTCTAGTACGTAAAT
rJMFF016P22+ TAAATAATATTAAAAATGTAGTCCTCTAGTACGTAAATTCATCTTNTCTACGACAACAAC
                      ____________________________________________________________
consensus TAAATAATATTAAAAATGTAGTCCTCTAGTACGTAAATTCATCTTNTCTACGACAACAAC