Previous Contig 008975:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006G21Sequence516008975 (6)pir|T05747|T057475e-51histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha632008975 (6)pir|T05747|T057478e-51histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha
JMFF016N12Sequence516008975 (6)pir|T05747|T057475e-51histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha620008975 (6)pir|T05747|T057478e-51histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha
JMFN029D17Sequence629008975 (6)pir|T05747|T057478e-51histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha
JMFN030H10Sequence526008975 (6)pir|T05747|T057472e-50histone H2A.M4I22.40 - Arabidopsis thaliana>gb:ATCHRIV66_1546604 Arabidopsis tha

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN030H10+ AAAAT
                      ____________________________________________________________
consensus AAAAT
 
. : . : . : . : . : . :
JMFN030H10+ CAAATAAACACCTCCTCCCCACCCAAACAAGACAAAAATCTGGCCTCGATCCATCTAATC
JMFF016N12+ CAAACAAGACAAAAATCCGGCCTCGATCCATCTAATC
JMFF006G21+ CAAACAAGACAAAAATCCGGCCTCGATCCATCTAATC
                      ____________________________________________________________
consensus CAAATAAACACCTCCTCCCCACCCAAACAAGACAAAAATCCGGCCTCGATCCATCTAATC
 
. : . : . : . : . : . :
JMFN030H10+ CTCATCAACGGGCTTTGAGGAGCCACCAGTCTTCTTCGGGAGCAAGAGATTGTGAATGTT
JMFF016N12+ CTCATCAACGGGCTTTGAGGAGCCACCAGTCTTCTTCGGGAGCAAGAGATTGTGAATGTT
rJMFF006G21- CTTCTTCGGGAGCAAGAGATTGTGAATGTT
JMFN029D17+ TTGTGAATGTT
JMFF006G21+ CTCATCAACGGGCTTTGAGGAGCCACCAGTCTTCTTCGGGAGCAAGAGATTGTGAATGTT
rJMFF016N12- CTTCTTCGGGAGCAAGAGATTGTGAATGTT
                      ____________________________________________________________
consensus CTCATCAACGGGCTTTGAGGAGCCACCAGTCTTCTTCGGGAGCAAGAGATTGTGAATGTT
 
. : . : . : . : . : . :
JMFN030H10+ CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
JMFF016N12+ CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
rJMFF006G21- CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
JMFN029D17+ CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
JMFF006G21+ CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
rJMFF016N12- CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
                      ____________________________________________________________
consensus CGGCATCACACCACCATTGGCAATAGTCACATCTCCAAGAAGCTTGCTCAGCTCCTCATC
 
. : . : . : . : . : . :
JMFN030H10+ GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
JMFF016N12+ GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
rJMFF006G21- GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
JMFN029D17+ GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
JMFF006G21+ GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
rJMFF016N12- GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
                      ____________________________________________________________
consensus GTTCCTCACAGCCAATTGGATGTGCCTCGGCACGATCCTAGTCTTCTTGTTGTCCCTCGC
 
. : . : . : . : . : . :
JMFN030H10+ AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
JMFF016N12+ AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
rJMFF006G21- AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
JMFN029D17+ AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
JMFF006G21+ AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
rJMFF016N12- AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
                      ____________________________________________________________
consensus AGCATTTCCAGCCAATTCAAGCACCTCAGCGGCAAGGTATTCGAGGACGGCGGCGAGATA
 
. : . : . : . : . : . :
JMFN030H10+ GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
JMFF016N12+ GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
rJMFF006G21- GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
JMFN029D17+ GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
JMFF006G21+ GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
rJMFF016N12- GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
                      ____________________________________________________________
consensus GACGGGAGCTCCGGCACCGACACGCTCGGCGTACTTGCCGGCCTTGAGGAAACGGGCGAT
 
. : . : . : . : . : . :
JMFN030H10+ ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTGTTGGCAGG
JMFF016N12+ ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
rJMFF006G21- ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
JMFN029D17+ ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
JMFF006G21+ ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
rJMFF016N12- ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
                      ____________________________________________________________
consensus ACGGCCGACGGGGAACTGGAGACCGGCCTTGCTGCTACGAGACTGAGCCTTCTTGGCAGG
 
. : . : . : . : . : . :
JMFN030H10+ ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
JMFF016N12+ ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
rJMFF006G21- ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
JMFN029D17+ ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
JMFF006G21+ ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
rJMFF016N12- ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
                      ____________________________________________________________
consensus ACCGGAACCAAGGGTTTTGCCACGACCCGCCATTGCTGTTTTAGTATTACGACTGAAGAA
 
. : . : . : . : . : . :
JMFN030H10+ GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGT
JMFF016N12+ GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGTTAACAAAATACTG
rJMFF006G21- GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGTTAACAAAATACTG
JMFN029D17+ GGGGTACAAAAGAGGGATTCGCTGTGAAATT
JMFF006G21+ GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGTTAACAAAATACTG
rJMFF016N12- GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGTTAACAAAATACTGGTTACTTT
                      ____________________________________________________________
consensus GGGGTACAAAAGAGGGATTCGCTGTGAAATTCAAGCGGTTAACAAAATACTGGTTACTTT