Previous Contig 008973:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009K06Sequence594008973 (10)gb:AY063063_15656405e-57Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co824008973 (10)gb:AY063063_15656401e-97Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co
JMFF016L07Sequence282008973 (10)gb:AY063063_15656403e-23Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co
JMFF016L16Sequence592008973 (10)gb:AY063063_15656402e-56Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co853008973 (10)gb:AY063063_1565640e-103Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co
JMSF030O13Sequence675008973 (10)gb:AY063063_15656409e-70Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co737008973 (10)gb:AY063063_15656408e-92Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co
JMSF042P15Sequence577020164pir|C71409|C714099e-54probable RNA polymerase II fifth largest subunit - Arabidopsis thaliana>gb:ATCHR545008973 (10)gb:AY063063_15656403e-52Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co
JMSF045J18Sequence792008973 (10)gb:AY063063_15656401e-89Arabidopsis thaliana putative phenylalanine-tRNA synthetase (At3g58140) mRNA, co691008973 (10)pir|T45974|T459741e-70phenylalanine-tRNA synthetase-like protein - Arabidopsis thaliana>gb:ATF9D24_155

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF030O13- GACAGCAGGTCAGCC
                      ____________________________________________________________
consensus GACAGCAGGTCAGCC
 
. : . : . : . : . : . :
JMFF016L16- GGAGCACAACTGCGATGGCTCTCTCATTTGCTCAATCTACCTTCTTCGTCTCC
JMFF009K06- GGAGCACAACTGCGATGGCTCTCTCATTTGCTCAATCTACCTTCTTCGTCTCC
JMSF030O13- ACTGTGTGGAGCACAACTGCGATGGCTCTCTCATTTGCTCAATCTACCTTCTTCGTCTCC
JMSF045J18- GGAGCACAACTGCGATGGCTCTCTCATTTGCTCAATCTACCTTCTTCGTCTCC
                      ____________________________________________________________
consensus ACTGTGTGGAGCACAACTGCGATGGCTCTCTCATTTGCTCAATCTACCTTCTTCGTCTCC
 
. : . : . : . : . : . :
JMFF016L16- ACTAGGCCCTCTCTCTTCCTCCGCAGAAATGGCGGCAGCCTTAAACGATGTAATGTTCTC
JMFF009K06- ACTAGGCCCTCTCTCTTCCTCCGCAGAAATGGCGGCAGCCTTAAACGATGTAATGTTCTC
JMSF030O13- ACTAGGCCCTCTCTCTTCCTCCGCAGAAATGGCGGCAGCCTTAAACGATGTAATGTTCTC
JMSF045J18- ACTAGGCCCTCTCTCTTCCTCCGCAGAAATGGCGGCAGCCTTAAACGATGTAATGTTCTC
                      ____________________________________________________________
consensus ACTAGGCCCTCTCTCTTCCTCCGCAGAAATGGCGGCAGCCTTAAACGATGTAATGTTCTC
 
. : . : . : . : . : . :
JMFF016L16- GCCTGTTTCACCAACTATTCTTCTTCCTTTCCCTATTCTACTGGTGCTATGCCTGCAGAT
JMFF009K06- GCCTGTTTCACCAACTATTCTTCTTCCTTTCCCTATTCTACTGGTGCTATGCCTGCAGAT
JMSF030O13- GCCTGTTTCACCAACTATTCTTCTTCCTTTCCCTATTCTACTGGTGCTATGCCTGCAGAT
JMSF045J18- GCCTGTTTCACCAACTATTCTTCTTCCTTTCCCTATTCTACTGGTGCTATGCCTGCAGAT
                      ____________________________________________________________
consensus GCCTGTTTCACCAACTATTCTTCTTCCTTTCCCTATTCTACTGGTGCTATGCCTGCAGAT
 
. : . : . : . : . : . :
JMFF016L16- AACAAAGCCCCCGTCCATCGCCACAGGTGGAGGGCACCCGTCGCCTCAGTTCTTGAGCTT
JMFF009K06- AACAAAGCCCCCGTCCATCGCCACAGGTGGAGGGCACCCGTCGCCTCAGTTCTTGAGCTT
JMSF030O13- AACAAAGCCCCCGTCCATCGCCACAGGTGGAGGGCACCCGTCGCCTCAGTTCTTGAGCTT
JMSF045J18- AACAAAGCCCCCGTCCATCGCCACAGGTGGAGGGCACCCGTCGCCTCAGTTCTTGAGCTT
                      ____________________________________________________________
consensus AACAAAGCCCCCGTCCATCGCCACAGGTGGAGGGCACCCGTCGCCTCAGTTCTTGAGCTT
 
. : . : . : . : . : . :
JMFF016L16- GGTGGCCTCAAGGTTTCCAAGGATGAAATAGTGAGGGATGACCCTACGAACAATGTCCCA
JMFF009K06- GGTGGCCTCAAGGTTTCCAAGGATGAAATAGTGAGGGATGACCCTACGAACAATGTCCCA
JMSF030O13- GGTGGCCTCAAGGTTTCCAAGGATGAAATAGTGAGGGATGACCCTACGAACAATGTCCCA
JMSF045J18- GGTGGCCTCAAGGTTTCCAAGGATGAAATAGTGAGGGATGACCCTACGAACAATGTCCCA
                      ____________________________________________________________
consensus GGTGGCCTCAAGGTTTCCAAGGATGAAATAGTGAGGGATGACCCTACGAACAATGTCCCA
 
. : . : . : . : . : . :
JMFF016L16- GATACAATATTCTCAAAGCTGGGAATGCAGCTTCATAGGAGGGATCAACATCCACTTGGT
JMFF009K06- GATACAATATTCTCAAAGCTGGGAATGCAGCTTCATAGGAGGGATCAACATCCACTTGGT
JMSF030O13- GATACAATATTCTCAAAGCTGGGAATGCAGCTTCATAGGAGGGATCAACATCCACTTGGT
JMSF045J18- GATACAATATTCTCAAAGCTGGGAATGCAGCTTCATAGGAGGGATCAACATCCACTTGGT
                      ____________________________________________________________
consensus GATACAATATTCTCAAAGCTGGGAATGCAGCTTCATAGGAGGGATCAACATCCACTTGGT
 
. : . : . : . : . : . :
JMFF016L16- ATCCTGAAGAATGCAATCTTTGATTACTTTGACACGAATTATCCAAACAAATTTGACAAG
JMFF009K06- ATCCTGAAGAATGCAATCTTTGATTACTTTGACACGAATTATCCAAACAAATTTGACAAG
JMSF030O13- ATCCTGAAGAATGCAATCTTTGATTACTTTGACACGAATTATCCAAACAAATTTGACAAG
JMSF045J18- ATCCTGAAGAATGCAATCTTTGATTACTTTGACACGAATTATCCAAACAAATTTGACAAG
                      ____________________________________________________________
consensus ATCCTGAAGAATGCAATCTTTGATTACTTTGACACGAATTATCCAAACAAATTTGACAAG
 
. : . : . : . : . : . :
JMFF016L16- TTTGATGATCTATGCCCTATAGTTTCTGTTAAACAGAACTTTGATGATGTACTGGTACCT
JMFF009K06- TTTGATGATCTATGCCCTATAGTTTCTGTTAAACAGAACTTTGATGATGTACTGGTACCT
JMSF030O13- TTTGATGATCTATGCCCTATAGTTTCTGTTAAACAGAACTTTGATGATGTACTGGTACCT
JMSF045J18- TTTGATGATCTATGCCCTATAGTTTCTGTTAAACAGAACTTTGATGATGTACTGGTACCT
                      ____________________________________________________________
consensus TTTGATGATCTATGCCCTATAGTTTCTGTTAAACAGAACTTTGATGATGTACTGGTACCT
 
. : . : . : . : . : . :
JMFF016L16- CCTGATCATGTTAGCAGGAGCTACAATGATACATATTACGTGGACTCTCAAACTGTTTTG
JMFF009K06- CCTGATCATGTTAGCAGGAGCTACAATGATACATATTACGTGGACTCTCAAACTGTTTTG
JMSF030O13- CCTGATCATGTTAGCAGGAGCTACAATGATACATATTACGTGGACTCTCAAACTGTTTTG
JMSF045J18- CCTGATCATGTTAGCAGGAGCTACAATGATACATATTACGTGGACTCTCAAACTGTTTTG
                      ____________________________________________________________
consensus CCTGATCATGTTAGCAGGAGCTACAATGATACATATTACGTGGACTCTCAAACTGTTTTG
 
. : . : . : . : . : . :
JMFF016L16- AGGTGCCACACAAGTGCACATCAAGCTGAGTTACTGAGCAGGGGTCATACTCATTTC
JMFF009K06- AGGTGCCACACAAGTGCACATCAAGCTGAGTTACTGAGCAGGGGTCATACTCATTTC
JMSF030O13- AGGTGCCACACAAGTGCACATCAAGCTGAGTTACTGAGCAGGGGTCATACTCATTTCCTT
JMSF045J18- AGGTGCCACACAAGTGCACATCAAGCTGAGTTACTGAGCAGGGGTCATACTCATTTCCTT
                      ____________________________________________________________
consensus AGGTGCCACACAAGTGCACATCAAGCTGAGTTACTGAGCAGGGGTCATACTCATTTCCTT
 
. : . : . : . : . : . :
JMSF030O13- GTTACTGGAGATGTTTACCGTAGAGATTCTATTGACTCAACTCACTACCCTGTTTTCCAC
JMSF045J18- GTTACTGGAGATGTTTACCGTAGAGATTCTATTGACTCAACTCACTACCCTGTTTTCCAC
                      ____________________________________________________________
consensus GTTACTGGAGATGTTTACCGTAGAGATTCTATTGACTCAACTCACTACCCTGTTTTCCAC
 
. : . : . : . : . : . :
JMSF045J18- CAGATGGAAGGAGTTCGGGTCTTTTCTCCAAATGATTGGGAGGGATCAGGCACTGATGCC
rJMFF009K06+ GGGATCAGNCACTGATGCC
rJMFF016L16+ GGGATCAGGCACTGATGCC
                      ____________________________________________________________
consensus CAGATGGAAGGAGTTCGGGTCTTTTCTCCAAATGATTGGGAGGGATCAGGCACTGATGCC
 
. : . : . : . : . : . :
JMSF045J18- ACATCTTATGCTGCTGCAGATCTAAAGATATGTCTCGAGGGATTGGCTCAACATTTATTT
rJMFF009K06+ ACATCTTATGCTGCTGCAGATCTAAAGATATGTCTCGAGGGATTGGCTCAACATTTATTT
rJMSF030O13+ ATTT
rJMFF016L16+ ACATCTTATGCTGCTGCAGATCTAAAGATATGTCTCGAGGGATTGGCTCAACATTTATTT
                      ____________________________________________________________
consensus ACATCTTATGCTGCTGCAGATCTAAAGATATGTCTCGAGGGATTGGCTCAACATTTATTT
 
. : . : . : . : . : . :
JMSF045J18- GGTGGTGTGGAGAT
rJMFF009K06+ GGTGGTGTGGAGATGCGTTGGGTCGACACATACTTTCCCTTTACCAATCCATCATTCGAA
rJMSF030O13+ GGTGGTGTGGAGATGCGTTGGGTCGACACATACTTTCCCTTTACCAATCCATCATTCGAA
rJMSF045J18+ AA
rJMFF016L16+ GGTGGTGTGGAGATGCGTTGGGTCGACACATACTTTCCCTTTACCAATCCATCATTCGAA
                      ____________________________________________________________
consensus GGTGGTGTGGAGATGCGTTGGGTCGACACATACTTTCCCTTTACCAATCCATCATTCGAA
 
. : . : . : . : . : . :
rJMFF009K06+ TTAGAGATATATTTTCAGG-AAAAGTGGATGGAAGTATTAGGTTGT-GGGGTAACAGAGC
rJMSF030O13+ TTAGAGATATATTTTCAGG-AAAAGTGGATGGAAGTATTAGGTTGT-GGGGTAACAGAGC
rJMSF045J18+ TTAGAGATATATNTTCAGGAAAAAGTGGATGGAAGTATTAGGTTGTGGGGGTAACAGAGC
rJMFF016L16+ TTAGAGATATATTTTCAGG-AAAAGTGGATGGAAGTATTAGGTTGT-GGGGTAACAGAGC
                      ____________________________________________________________
consensus TTAGAGATATATTTTCAGG-AAAAGTGGATGGAAGTATTAGGTTGT-GGGGTAACAGAGC
 
. : . : . : . : . : . :
rJMFF009K06+ AAGAAATACTGAAAAGAAGTGGGAGAACCAATAATGTTGCTTGGGCTTTTGGACTTGGAT
rJMSF030O13+ AAGAAATACTGAAAAGAAGTGGGAGAACCAATAATGTTGCTTGGGCTTTTGGACTTGGAT
rJMSF045J18+ AAGAAATACTGAAAAGAAGTGGGAGAACCAATAATGTTGCTTGGGCTTTTGGACTTGGAT
rJMFF016L16+ AAGAAATACTGAAAAGAAGTGGGAGAACCAATAATGTTGCTTGGGCTTTTGGACTTGGAT
                      ____________________________________________________________
consensus AAGAAATACTGAAAAGAAGTGGGAGAACCAATAATGTTGCTTGGGCTTTTGGACTTGGAT
 
. : . : . : . : . : . :
rJMFF009K06+ TGGAACGATTGGCAATGGTTCTCTTTGATATTCCAGATATCCGAC-TTTTCTGGTCTGCA
rJMSF030O13+ TGGAACGATTGGCAATGGTTCTCTTTGATATTCCAGATATCCGAC-TTTTCTGGTCTGCA
rJMSF045J18+ TGGAACGATTGGCAATGGTTCTCTTTGATATTCCAGATATCCGAC-TTTTCTGGTCTGCA
rJMSF042P15+ TTCTCTTTGATATTCCAGATATCCGACTTTTTCTGGTCTGCA
rJMFF016L16+ TGGAACGATTGGCAATGGTTCTCTTTGATATTCCAGATATCCGAC-TTTTCTGGTCTGCA
                      ____________________________________________________________
consensus TGGAACGATTGGCAATGGTTCTCTTTGATATTCCAGATATCCGAC-TTTTCTGGTCTGCA
 
. : . : . : . : . : . :
rJMFF009K06+ GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
rJMSF030O13+ GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
rJMSF045J18+ GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
rJMSF042P15+ GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
rJMFF016L16+ GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
                      ____________________________________________________________
consensus GATGAGCGTTTTACTTCTCAATTTTCAAGTGGCCAACTTGGAGTGAAGTTCAAGCCATTT
 
. : . : . : . : . : . :
rJMFF016L07+ TGATTCATTCNCCGAG
rJMFF009K06+ TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGTGATTCATTCACCGAG
rJMSF030O13+ TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGTGATTCATTCACCGAG
rJMSF045J18+ TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGTGATTCATTCACCGAG
rJMSF042P15+ TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGCGATTCATTCACCGAG
rJMFF016L16+ TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGTGATTCATTCACCGAG
                      ____________________________________________________________
consensus TCTAAGTATCCTCCATGCTACAAAGACATGAGTTTCTGGATCAGTGATTCATTCACCGAG
 
. : . : . : . : . : . :
rJMFF016L07+ AACAACCTTTGTGAAGTTNTTAGAGGAATTNCCGGGGATNTCGTGGAAGAGGTGCAACTA
rJMFF009K06+ AACAACCTTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
rJMSF030O13+ AACAACCTTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
rJMSF045J18+ AACAACCCTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
rJMSF042P15+ AACAACCTTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
rJMFF016L16+ AACAACCTTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
                      ____________________________________________________________
consensus AACAACCTTTGTGAAGTTGTTAGAGGAATTGCCGGGGATCTTGTGGAAGAGGTGCAACTA
 
. : . : . : . : . : . :
rJMFF016L07+ ATAGACAACTTCANGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCNA
rJMFF009K06+ ATAGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
rJMSF030O13+ ATAGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
rJMSF045J18+ ATAGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
rJMSF042P15+ ATCGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
rJMFF016L16+ ATAGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
                      ____________________________________________________________
consensus ATAGACAACTTCACGAATAAGAAAGGAATGACCAGTCACTGCTATAGGATTGCTTACCGA
 
. : . : . : . : . : . :
rJMFF016L07+ TCCATGGAGCGCTCACTCACAGATGAGGAAATANACGATTTGCAGTGGAAAGTAAGAGAT
rJMFF009K06+ TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
rJMSF030O13+ TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
rJMSF045J18+ TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
rJMSF042P15+ TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
rJMFF016L16+ TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
                      ____________________________________________________________
consensus TCCATGGAGCGCTCACTCACAGATGAGGAAATAAACGATTTGCAGTGGAAAGTAAGAGAT
 
. : . : . : . : . : . :
rJMFF016L07+ CAAGTGGAGAGCAAANTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTANNTTCC
rJMFF009K06+ CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTATTTTCC
rJMSF030O13+ CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTATTTTCC
rJMSF045J18+ CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTATTTTCC
rJMSF042P15+ CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTATTCCTTCCTTCCTTATTTTCC
rJMFF016L16+ CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTATTTTCC
                      ____________________________________________________________
consensus CAAGTGGAGAGCAAATTAAAAGTCGTTCTTAGATGAGTA----TTCCTTCCTTATTTTCC
 
. : . : . : . : . : . :
rJMFF016L07+ GCTTTTATTCTNTCTGTACCGGGAAAATAT
rJMFF009K06+ GCTTTTCTTCTCTCTGTACCGGGAAAATATATTATACCTTTTCTGGACTTGTTTTACCCT
rJMSF030O13+ GCTTTTCTTCTCTCTGTACCGGGAAAATATATTATACCTTTTCTGGACTTGTTTTACCCT
rJMSF045J18+ GCTTTTCTTCTCTCTGTACCGGGAAAATATATTATACCTTTTCTGGACTTGTTTTACCCT
rJMSF042P15+ GCTTTTCTTCTCTCTGTGCCGGGAA
rJMFF016L16+ GCTTTTCTTCTCTCTGTACCGGGAAAATATATTATACCTTTTCTGGACTTGTTTTACCCT
                      ____________________________________________________________
consensus GCTTTTCTTCTCTCTGTACCGGGAAAATATATTATACCTTTTCTGGACTTGTTTTACCCT
 
. : . : . : . : . : . :
rJMFF009K06+ GCTAGTTCATTGCACTTGTAGATTGTATAGGGAAAGGAAAACCTTAGTGAATTTGCTGTC
rJMSF030O13+ GCTAGTTCATTGCACTTGTAGATTGTATAGGGAAAGGAAAACCTTAGTGAATTTGCTGTC
rJMSF045J18+ GCTAGTTCATTGCACTTGTAGATTGTATAGGGAAAGGAAAACCTTAGTGAATTTGCTGTC
rJMFF016L16+ GCTAGTTCATTGCACTTGTAGATTGTATAGGGAAAGGAAAACCTTAGTGGATTTGCTGTC
                      ____________________________________________________________
consensus GCTAGTTCATTGCACTTGTAGATTGTATAGGGAAAGGAAAACCTTAGTGAATTTGCTGTC
 
. : . : . : . : . : . :
rJMFF009K06+ ATTT
rJMSF030O13+ ATTATTAG-TTTGAAGCCAAT
rJMSF045J18+ ATTTTTAGTTTTGAAGCCAATTGTTCTAATAA
rJMFF016L16+ ATTTTTAGTTTTGAAGCCAATTGTTCTAATAATATGTCAAGAATGAGCAATAACAAGATC
                      ____________________________________________________________
consensus ATTTTTAGTTTTGAAGCCAATTGTTCTAATAATATGTCAAGAATGAGCAATAACAAGATC