Previous Contig 008971:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016K07Sequence520000850 (2)gb:AY054642_15632967e-37Arabidopsis thaliana similar to glutamate synthase (At1g62570; T3P18.13) mRNA, c301008971 (2)gb:AY084698_15697855e-15Arabidopsis thaliana clone 115376 mRNA, complete sequence.
JMFF028K24Sequence453000850 (2)gb:AY039861_15603759e-34Arabidopsis thaliana At1g62600/T3P18_16 mRNA, complete cds.>gb:BT000506_1634784 698008971 (2)gb:AY084698_15697859e-50Arabidopsis thaliana clone 115376 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF028K24+ CGGTGGTGTTGTAAGCGTGGATGAGAACCGTGTAGGGCC
                      ____________________________________________________________
consensus CGGTGGTGTTGTAAGCGTGGATGAGAACCGTGTAGGGCC
 
. : . : . : . : . : . :
rJMFF028K24+ ACTCTACAAGCATGTTTTTCCACCGGCCTTAGCCCCGGGGCTTTCATTTGTTGGGATCCC
                      ____________________________________________________________
consensus ACTCTACAAGCATGTTTTTCCACCGGCCTTAGCCCCGGGGCTTTCATTTGTTGGGATCCC
 
. : . : . : . : . : . :
rJMFF028K24+ GTGGAAGGTATAATCCTTTCACATACGCACATTTCCCGGTTTTGCACACTTAGCTAATCG
                      ____________________________________________________________
consensus GTGGAAGGTATAATCCTTTCACATACGCACATTTCCCGGTTTTGCACACTTAGCTAATCG
 
. : . : . : . : . : . :
rJMFF028K24+ AGCGTTTTACGTTTATGGTGGATGAGCAAGGCGTTTTGTTGTGTTGTTTCCAGGTCGTTC
                      ____________________________________________________________
consensus AGCGTTTTACGTTTATGGTGGATGAGCAAGGCGTTTTGTTGTGTTGTTTCCAGGTCGTTC
 
. : . : . : . : . : . :
rJMFF028K24+ CGTTTATTTTGTGTGAATTACAGAGCAAGTGGATCGCCAGGGTCCTATCTGGCCGAGTTT
                      ____________________________________________________________
consensus CGTTTATTTTGTGTGAATTACAGAGCAAGTGGATCGCCAGGGTCCTATCTGGCCGAGTTT
 
. : . : . : . : . : . :
rJMFF028K24+ GTCTTCCACCGGAGGAGGAAATGATGGCTGACGTTGAAACTCTCTACTCGGATATGGAGA
                      ____________________________________________________________
consensus GTCTTCCACCGGAGGAGGAAATGATGGCTGACGTTGAAACTCTCTACTCGGATATGGAGA
 
. : . : . : . : . : . :
rJMFF028K24+ AACATGGCACGCTAAAACGATACACCCATCGAGTAGGCGAGCATCAGTTTGAGTACGACG
rJMFF016K07+ G
                      ____________________________________________________________
consensus AACATGGCACGCTAAAACGATACACCCATCGAGTAGGCGAGCATCAGTTTGAGTACGACG
 
. : . : . : . : . : . :
rJMFF028K24+ ACTGGATAGCTGCCCAGTGTGATTTTCCAGCAATCGAAGAATGGAGAAAGGAAATGTATT
rJMFF016K07+ ACTGGATAGCTGCCCAGTGTGATTTTCCAGCAATCGAAGAATGGAGAAAGGAAATGTATT
                      ____________________________________________________________
consensus ACTGGATAGCTGCCCAGTGTGATTTTCCAGCAATCGAAGAATGGAGAAAGGAAATGTATT
 
. : . : . : . : . : . :
rJMFF028K24+ CCGCGACTGGCCTGAGAAAAAGAGGACAGCCCGAGACATACCGCGATCTATGGGACGATG
rJMFF016K07+ CCGCGACTGGCCTGAGAAAAAGAGGACAGCCCGAGACATACCGCGATCTATGGGACGATG
                      ____________________________________________________________
consensus CCGCGACTGGCCTGAGAAAAAGAGGACAGCCCGAGACATACCGCGATCTATGGGACGATG
 
. : . : . : . : . : . :
rJMFF028K24+ AACACTTGATTTCACAGGCAAATGAAGACTTCATGAGATATATTATTCCAAAGGTCCCAA
rJMFF016K07+ AACACTTGATTTCACAGGCAAATGAAGACTTCATGAGATATATTATTCCAAAGGTCCCAA
                      ____________________________________________________________
consensus AACACTTGATTTCACAGGCAAATGAAGACTTCATGAGATATATTATTCCAAAGGTCCCAA
 
. : . : . : . : . : . :
rJMFF028K24+ TAACTAAACTGTGAAATATTGCAACTTACATTTTATAGACTTATCAAGTACACACTGCAT
rJMFF016K07+ TAACTAAACTGTGAAATATTGCAACTTACATTTTATAGACTTATCAAGTACACACTGCAT
                      ____________________________________________________________
consensus TAACTAAACTGTGAAATATTGCAACTTACATTTTATAGACTTATCAAGTACACACTGCAT
 
. : . : . : . : . : . :
rJMFF028K24+ AATATTATCTGTACAACCATATCACAGCAGTCACATTCTTCATTGATTAAATAAATGAA
rJMFF016K07+ AATATTATCTGTACAACCATATCACAGCAGTCACATTCTTCATTGATTAAATAAATGAAA
                      ____________________________________________________________
consensus AATATTATCTGTACAACCATATCACAGCAGTCACATTCTTCATTGATTAAATAAATGAAA