Previous Contig 008970:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016J22Sequence603001156 (5)gb:AY319479_15987241e-54Brassica napus phosphoethanolamine N-methyltransferase mRNA, complete cds.821008970 (2)sp|Q944H0|PEM2_ARATH1e-98Putative phosphoethanolamine N-methyltransferase 2 (EC 2.1.1.103).>gb:AY063866_1
JMFF050P19Sequence623001156 (5)gb:AY319479_15987244e-58Brassica napus phosphoethanolamine N-methyltransferase mRNA, complete cds.606008970 (2)sp|Q944H0|PEM2_ARATH4e-61Putative phosphoethanolamine N-methyltransferase 2 (EC 2.1.1.103).>gb:AY063866_1

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016J22+ GCCGGGGCAAAAGGTCCTAGATGTTGGCTGTGGTATTGGAG
                      ____________________________________________________________
consensus GCCGGGGCAAAAGGTCCTAGATGTTGGCTGTGGTATTGGAG
 
. : . : . : . : . : . :
rJMFF016J22+ GAGGTGATTTCTACATGGCTGAGAACTACGAGGTTCATGTTGTTGGCATTGACCTCTCTA
                      ____________________________________________________________
consensus GAGGTGATTTCTACATGGCTGAGAACTACGAGGTTCATGTTGTTGGCATTGACCTCTCTA
 
. : . : . : . : . : . :
rJMFF016J22+ TTAACATGATCTCATTCGCTATCGAACGTGCTATTGGCCTCAAATGCACCGTTGAGTTTG
                      ____________________________________________________________
consensus TTAACATGATCTCATTCGCTATCGAACGTGCTATTGGCCTCAAATGCACCGTTGAGTTTG
 
. : . : . : . : . : . :
rJMFF050P19+ GATGTGATTTACAGCC
rJMFF016J22+ AGGTTGCTGATTGCACCAGGAAATCATACCCTGATGGCTCATTGGATGTGATTTACAGCC
                      ____________________________________________________________
consensus AGGTTGCTGATTGCACCAGGAAATCATACCCTGATGGCTCATTGGATGTGATTTACAGCC
 
. : . : . : . : . : . :
rJMFF050P19+ GTGACACCTTTCTTCACATTCATGACAAACCTGCACTTTTCAAGTCTTTCTACAGGTGGC
rJMFF016J22+ GTGACACCTTTCTTCACATTCATGACAAACCTGCACTTTTCAAGTCTTTCTACAGGTGGC
                      ____________________________________________________________
consensus GTGACACCTTTCTTCACATTCATGACAAACCTGCACTTTTCAAGTCTTTCTACAGGTGGC
 
. : . : . : . : . : . :
rJMFF050P19+ TGAAGCCAGGGGGTAAACTCCTCATTACTGATTACTGCAAAGCAGCTGGAACTCCATCAC
rJMFF016J22+ TGAAGCCAGGGGGTAAACTCCTCATTACTGATTACTGCAAAGCAGCTGGAACTCCATCAC
                      ____________________________________________________________
consensus TGAAGCCAGGGGGTAAACTCCTCATTACTGATTACTGCAAAGCAGCTGGAACTCCATCAC
 
. : . : . : . : . : . :
rJMFF050P19+ AAGAATTTGCCGAGTATATTAAACACAGAGGATATGATTTACACGATGTAGCAGCATATG
rJMFF016J22+ AAGAATTTGCCGAGTATATTAAACACAGAGGATATGATTTACACGATGTAGCAGCATATG
                      ____________________________________________________________
consensus AAGAATTTGCCGAGTATATTAAACACAGAGGATATGATTTACACGATGTAGCAGCATATG
 
. : . : . : . : . : . :
rJMFF050P19+ GCCAGATGATCAAGGATGCTGGGTTCAATGACGTCATTGCTGAGGATCGATCTCATCAGT
rJMFF016J22+ GCCAGATGATCAAGGATGCTGGGTTCAATGACGTCATTGCTGAGGATCGATCTCATCAGT
                      ____________________________________________________________
consensus GCCAGATGATCAAGGATGCTGGGTTCAATGACGTCATTGCTGAGGATCGATCTCATCAGT
 
. : . : . : . : . : . :
rJMFF050P19+ TCATGAACGTGCTCCAGAAGGAGTTAGACACCGTGGAGAAGGAAAAAGAAGCATTTATCC
rJMFF016J22+ TCATGAACGTGCTCCAGAAGGAGTTAGACACCGTGGAGAAGGAAAAAGAAGCATTTATCC
                      ____________________________________________________________
consensus TCATGAACGTGCTCCAGAAGGAGTTAGACACCGTGGAGAAGGAAAAAGAAGCATTTATCC
 
. : . : . : . : . : . :
rJMFF050P19+ AAGACTTCTCAGAAGAGGACTACAATGATATCGTTGATGGGTGGAGGGCGAAGCTGGCGA
rJMFF016J22+ AAGACTTCTCAGAAGAGGACTACAATGATATCGTTGATGGGTGGAGGGCGAAGCTGGCGA
                      ____________________________________________________________
consensus AAGACTTCTCAGAAGAGGACTACAATGATATCGTTGATGGGTGGAGGGCGAAGCTGGCGA
 
. : . : . : . : . : . :
rJMFF050P19+ GATCTTCATCCGGGGAGCAGAGATGGGGCTTGTTCATTGCCAAGAAG
rJMFF016J22+ GATCTTCATCCGGGGAGCAGAGATGGGGCTTGTTCATTGCCAAGAAGTGAAGTGATGTCT
                      ____________________________________________________________
consensus GATCTTCATCCGGGGAGCAGAGATGGGGCTTGTTCATTGCCAAGAAGTGAAGTGATGTCT
 
. : . : . : . : . : . :
rJMFF016J22+ TCTGAAATGAACATTATGACAACAAGCAACAACATATGGGCTTAGTATTGATGAAACCTC
                      ____________________________________________________________
consensus TCTGAAATGAACATTATGACAACAAGCAACAACATATGGGCTTAGTATTGATGAAACCTC
 
. : . : . : . : . : . :
rJMFF016J22+ CTAGTGTCGTTTTCAATAATTTGGGTGAATGTTTTGCTATGTAATAATGGCACCATATGT
                      ____________________________________________________________
consensus CTAGTGTCGTTTTCAATAATTTGGGTGAATGTTTTGCTATGTAATAATGGCACCATATGT
 
. : . : . : . : . : . :
rJMFF016J22+ TGTATAAGTTGGTATCTTCCCATGATAATAATGTGTTATGTGAAGACTGAAATCCAGTTG
                      ____________________________________________________________
consensus TGTATAAGTTGGTATCTTCCCATGATAATAATGTGTTATGTGAAGACTGAAATCCAGTTG