Previous Contig 008964:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G01Sequence453008964 (7)gb:AY062509_15651651e-30Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMFF016F24Sequence519004535 (7)gb:AY062509_15651651e-19Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1749008964 (7)gb:AY062509_15651658e-74Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMFF022L09Sequence461004535 (7)gb:AY062509_15651653e-14Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1726008964 (7)gb:AY062509_15651651e-74Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMFF028B22Sequence516004535 (7)gb:AY062509_15651652e-20Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1699008964 (7)gb:AY062509_15651654e-73Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMSF003K07Sequence339004535 (7)766008964 (7)gb:AY062509_15651657e-80Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMSF006J01Sequence397004535 (7)gb:AY062509_15651658e-08Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1451008964 (7)gb:AY062509_15651652e-30Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1
JMSF042O13Sequence766004535 (7)gb:AY062509_15651654e-60Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1642008964 (7)gb:AY062509_15651654e-68Arabidopsis thaliana Unknown protein (F6I1.13) mRNA, complete cds.>gb:AY093301_1

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF003K07+ TGGAGAGGGGCAGGTGTTGGACTCCCAAAAGGTG
                      ____________________________________________________________
consensus TGGAGAGGGGCAGGTGTTGGACTCCCAAAAGGTG
 
. : . : . : . : . : . :
rJMSF003K07+ ATCAAACTATGGCAATACCTGAGGGTCTCACTCTATTTGATCTTGGTGAAAGTGGTATTA
rJMFF028B22+ GTTGAAAGTGGTATTA
rJMFF022L09+ CTCTATTTGATCTTGTTGAAAGTGGTATTA
rJMFF016F24+ CTCTATTTGATCTNGTTGAAAGTGGTATTA
                      ____________________________________________________________
consensus ATCAAACTATGGCAATACCTGAGGGTCTCACTCTATTTGATCTTGTTGAAAGTGGTATTA
 
. : . : . : . : . : . :
rJMSF003K07+ GCAACACAAACGCATCTGTTGGAGTGGTTGTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
rJMFF028B22+ GCAACACAAACGCATCTGTTGGAGTGGTTGTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
rJMSF042O13+ GTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
rJMFF022L09+ GCAACACAAACGCATCTGTTGGAGTGGTTGTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
rJMFF016F24+ GCAACACAAACGCATCTGTTGGAGTGGTTGTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
                      ____________________________________________________________
consensus GCAACACAAACGCATCTGTTGGAGTGGTTGTTCGTTTGAGGCAAGAATTGTCTCTTGTGA
 
. : . : . : . : . : . :
rJMSF003K07+ AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
rJMFF028B22+ AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
rJMSF042O13+ AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
rJMFF022L09+ AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
rJMFF016F24+ AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
                      ____________________________________________________________
consensus AAGATATGCCTGTTCTTATTGCAATTGACCAATATAACAATTGGTTTACATTCAGCGAGT
 
. : . : . : . : . : . :
rJMSF003K07+ ACGAGGAACCAGTAACAGTACGGTCTTGCAAACCCATCCATGCTAGGGAACTTACAACTG
rJMFF028B22+ ACGAGGAACCAGTAACAGTACGGTCTTGCAAACCCATCCATGCTAGGGAACTTACAACTG
rJMSF042O13+ ACGAGGAACCAGTAACAGTACGGTCTTGCAAACCCATCCATGCTAGGGAACTTACAACTG
rJMFF022L09+ ACGAGGAACCAGTAACAGTACGGTCTTGCAAACCCATCCATGCTAGGGAACTTACAACTG
rJMFF016F24+ ACGAGGAACCAGTAACAGTACGGTCTNGCAAACCCATCCATGCTAGGGAACTTACAACTG
                      ____________________________________________________________
consensus ACGAGGAACCAGTAACAGTACGGTCTTGCAAACCCATCCATGCTAGGGAACTTACAACTG
 
. : . : . : . : . : . :
rJMSF003K07+ TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
rJMFF028B22+ TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
rJMSF006J01+ TGGTGCTTTCTCTCATTCAA
rJMFF001G01+ ACATGATGGNTGGTGCTTTCTNTCATTCAN
rJMSF042O13+ TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
rJMFF022L09+ TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
rJMFF016F24+ TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
                      ____________________________________________________________
consensus TCAATGCATTTAGGTCCATGCTTCACAATGACATGATGGTTGGTGCTTTCTCTCATTCAA
 
. : . : . : . : . : . :
rJMSF003K07+ CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
rJMFF028B22+ CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
rJMSF006J01+ CTGCAGTAGGGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
rJMFF001G01+ NTGCAGTA-GGGAAANTGNGTCAAGANTTACCAAATGTTCCCCCTGATGCCCGATTAAAT
rJMSF042O13+ CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
rJMFF022L09+ CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
rJMFF016F24+ CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
                      ____________________________________________________________
consensus CTGCAGTA-GGGAAACTGCGTCAAGACTTACCAAATGTTCCCACTGATGCCCGATTAAAT
 
. : . : . : . : . : . :
rJMSF003K07+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
rJMFF028B22+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
rJMSF006J01+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
rJMFF001G01+ TTTCCGCGATATACTTTGGNCGAAGCTGNTGCTGTTTGTCATTNCTATCTCAGGCAAAGG
rJMSF042O13+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
rJMFF022L09+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCCGTTTGTCATTACTATCTCAGGCAAAGG
rJMFF016F24+ TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
                      ____________________________________________________________
consensus TTTCCTCGATATACTTTGGACGAAGCTGCTGCTGTTTGTCATTACTATCTCAGGCAAAGG
 
. : . : . : . : . : . :
rJMSF003K07+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMFF028B22+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMSF006J01+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMFF001G01+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMSF042O13+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMFF022L09+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
rJMFF016F24+ CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
                      ____________________________________________________________
consensus CTTATACGTCGAGAATCATTCTCAGAAGAAAACTGGAAGAAGATCTACTACCTGTCCAAT
 
. : . : . : . : . : . :
rJMSF003K07+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMFF028B22+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMSF006J01+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMFF001G01+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMSF042O13+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMFF022L09+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
rJMFF016F24+ GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
                      ____________________________________________________________
consensus GGAAATGGAGCAGAGCTGAGATGGCTGGTACCCTTCATGAGATGATGCTTCGAACATTAA
 
. : . : . : . : . : . :
rJMSF003K07+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMFF028B22+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMSF006J01+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMFF001G01+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMSF042O13+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMFF022L09+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
rJMFF016F24+ AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
                      ____________________________________________________________
consensus AATACAAGCAAATATTTAGTGTGATTCAAACACGGAAGAGGTTTGGTCTAACTATCAACT
 
. : . : . : . : . : . :
rJMSF003K07+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMFF028B22+ TTTCATCAGCTTTGATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMSF006J01+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMFF001G01+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMSF042O13+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMFF022L09+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
rJMFF016F24+ TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
                      ____________________________________________________________
consensus TTTCATCAGCTTTAATAAGGTTGTGCTGTTCTTTCAAGTACTTGATCTTTACATAGGAAT
 
. : . : . : . : . : . :
rJMSF003K07+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAACCATTGTAT
rJMFF028B22+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
rJMSF006J01+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
rJMFF001G01+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
rJMSF042O13+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
rJMFF022L09+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
rJMFF016F24+ TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATNGTAT
                      ____________________________________________________________
consensus TGCCAAGGTTGGTAAAATTTTGTCCAGTCTGGTGATATTTACTCCCTTAAA-CATTGTAT
 
. : . : . : . : . : . :
rJMSF003K07+ TATCTTGAGGATG
rJMFF028B22+ TATCTTGAGGATGTGAATTAT
rJMSF006J01+ TATCT
rJMFF001G01+ TATCT
rJMSF042O13+ TATCTTGAGGATG
rJMFF022L09+ TATCTTGAGGATGTGAATTATTGAGTATTAATTACTAC
rJMFF016F24+ TATCTTGAGGATGTGAATTATTGAGTATTAATTACTACCTTAAAGCATTGTCACCCAACT
                      ____________________________________________________________
consensus TATCTTGAGGATGTGAATTATTGAGTATTAATTACTACCTTAAAGCATTGTCACCCAACT