Previous Contig 008961:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001C24Sequence520008961 (12)gb:AP003508_18300765e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047741008961 (12)gb:AP003508_18300762e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMFF016E22Sequence505008961 (12)gb:AP003508_18300764e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047845008961 (12)gb:AP003508_18300761e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMFF016O22Sequence521008961 (12)gb:AP003508_18300765e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047738008961 (12)gb:AP003508_18300765e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMFF032M13Sequence534008961 (12)gb:AP003508_18300765e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047684008961 (12)gb:AP003508_18300767e-15Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF016I05Sequence614008961 (12)gb:AP003508_18300767e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047735008961 (12)gb:AP003508_18300761e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047
JMSF050H05Sequence679008961 (12)gb:AP003508_18300769e-39Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047737008961 (12)gb:AP003508_18300765e-25Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P047

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001C24- TAGTTGCACCACTCTTCCCCACC
JMFF016O22- GTTGCACCACTCTTCCCCACC
JMSF016I05- GCACCACTCTTCCCCACC
JMFF032M13- TTGCACCACTCTTCCCCACC
JMFF016E22- GTTGCACCACTCTTCCCCACC
JMSF050H05- GTTGCACCACTCTTCCCCACC
                      ____________________________________________________________
consensus TAGTTGCACCACTCTTCCCCACC
 
. : . : . : . : . : . :
JMFF001C24- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
JMFF016O22- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
JMSF016I05- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
JMFF032M13- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
JMFF016E22- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
JMSF050H05- GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
                      ____________________________________________________________
consensus GAGTTCTAACTTTCCGAACACCTCCTAGGGTTTTAGGCCCCCGATTCCCATTTTGAAAAC
 
. : . : . : . : . : . :
JMFF001C24- CCCTTACCCTTATTCTCGTTTCTTCTCCCAAAAGGTGCCAGCGTTTGAGTTGTAGGCAAG
JMFF016O22- CCCTTACCCTTATTCTCGTTTCTTCTCCCAAAAGGTGCCAGCGTTTGAGTTGTAGGCAAG
JMSF016I05- CCCTTACCCTTATTCTC----------------GGTGCCAGCGTTTGAGTTGTAGGCAAG
JMFF032M13- CCCTTACCCTTATTCTC----------------GGTGCCAGCGTTTGAGTTGTAGGCAAG
JMFF016E22- CCCTTACCCTTATTCTC----------------GGTGCCAGCGTTTGAGTTGTAGGCAAG
JMSF050H05- CCCTTACCCTTATTCTC----------------GGTGCCAGCGTTTGAGTTGTAGGCAAG
rJMFF016E22+ AGGCAAG
                      ____________________________________________________________
consensus CCCTTACCCTTATTCTC----------------GGTGCCAGCGTTTGAGTTGTAGGCAAG
 
. : . : . : . : . : . :
JMFF001C24- ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
JMFF016O22- ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
JMSF016I05- ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
JMFF032M13- --ACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
JMFF016E22- ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
JMSF050H05- ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
rJMFF016E22+ ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
                      ____________________________________________________________
consensus ACACAATGTCCAGGGTGTACGTTGGGAATGTGGATCCCCGAGCAACGGAGAGGGAGCTCG
 
. : . : . : . : . : . :
JMFF001C24- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
JMFF016O22- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
JMSF016I05- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
JMFF032M13- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
JMFF016E22- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
JMSF050H05- AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
rJMSF050H05+ CCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
rJMSF016I05+ TTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
rJMFF001C24+ GTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
rJMFF016O22+ CTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
rJMFF016E22+ AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
                      ____________________________________________________________
consensus AGGATGAATTTCGCATTTACGGTGTCCTTCGGAGTGTATGGGTAGCTAGAAGACCACCAG
 
. : . : . : . : . : . :
JMFF001C24- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
JMFF016O22- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
JMSF016I05- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
JMFF032M13- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
JMFF016E22- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
JMSF050H05- GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMSF050H05+ GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMSF016I05+ GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMFF001C24+ GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMFF016O22+ GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMFF032M13+ TGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
rJMFF016E22+ GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
                      ____________________________________________________________
consensus GTTATGCATTTATTGAGTTTGATGATCGCAGGGATGCACTAGATGCTGTCCGTGGATTGG
 
. : . : . : . : . : . :
JMFF001C24- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
JMFF016O22- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
JMSF016I05- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
JMFF032M13- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
JMFF016E22- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
JMSF050H05- ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMSF050H05+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMSF016I05+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMFF001C24+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMFF016O22+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMFF032M13+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
rJMFF016E22+ ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
                      ____________________________________________________________
consensus ATGGAAAGAATGGCTGGCGTGTGGAGCTTTCTCACAATTCTAGTGGAGGCCGTGGTGGCC
 
. : . : . : . : . : . :
JMFF001C24- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
JMFF016O22- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
JMSF016I05- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
JMFF032M13- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
JMFF016E22- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
JMSF050H05- GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMSF050H05+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMSF016I05+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMFF001C24+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMFF016O22+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMFF032M13+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
rJMFF016E22+ GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
                      ____________________________________________________________
consensus GTAGCCGCGGTGGAGGTGATGATTCAAAGTGTTATGAATGTGGTGAACCTGGTCATTTTG
 
. : . : . : . : . : . :
JMFF001C24- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
JMFF016O22- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
JMSF016I05- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
JMFF032M13- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
JMFF016E22- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
JMSF050H05- CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMSF050H05+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMSF016I05+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMFF001C24+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMFF016O22+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMFF032M13+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
rJMFF016E22+ CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
                      ____________________________________________________________
consensus CTCGTGAATGCCGTTTGCGCGTGGGCCCAAGAGGATTGGGAAGTGGACGCCGCCGAAGTC
 
. : . : . : . : . : . :
JMFF001C24- CTAGTCCTCGACGACGT
JMFF016O22- CTAGTCCTCGACGACGTA
JMSF016I05- CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
JMFF032M13- CTAGTCCTCGACGACGTANGAGCCCAAGTTATGGGCGGAGGAGCTATAGT
JMFF016E22- CTAGTCCTCGACGACGTAG
JMSF050H05- CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMSF050H05+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMSF016I05+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMFF001C24+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMFF016O22+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMFF032M13+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
rJMFF016E22+ CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
                      ____________________________________________________________
consensus CTAGTCCTCGACGACGTAGGAGCCCAAGTTATGGGCGGAGGAGCTATAGTCCTCTTGGCA
 
. : . : . : . : . : . :
JMSF016I05- AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
JMSF050H05- AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMSF050H05+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMSF016I05+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMFF001C24+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMFF016O22+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMFF032M13+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
rJMFF016E22+ AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
                      ____________________________________________________________
consensus AGCGATCCCCGCCACGTCGCAACCTTTCTCCTCGTCGTGGTAGGAGTTACAGCAGGTCAC
 
. : . : . : . : . : . :
JMSF016I05- CTCCTTATCGC
JMSF050H05- CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMSF050H05+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMSF016I05+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMFF001C24+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMFF016O22+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMFF032M13+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
rJMFF016E22+ CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
                      ____________________________________________________________
consensus CTCCTTATCGCCGTGGTCATCGAGATTCACCAAATGGCAATGGTTCACCAGCATATCGCC
 
. : . : . : . : . : . :
JMSF050H05- GTGGCCGTCGTG
rJMSF050H05+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
rJMSF016I05+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
rJMFF001C24+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
rJMFF016O22+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
rJMFF032M13+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
rJMFF016E22+ GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
                      ____________________________________________________________
consensus GTGGCCGTCGTGAATCACCCTATGCAAATGGAGATTGAAGATTTGAGTAGTGAAGATGAG
 
. : . : . : . : . : . :
rJMSF050H05+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
rJMSF016I05+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
rJMFF001C24+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
rJMFF016O22+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
rJMFF032M13+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
rJMFF016E22+ GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
                      ____________________________________________________________
consensus GAAATGCTCAAGGATCTTTGATGTTCTGTAGTCTGTCTGATAGGCTTGATGGAAGAGTAA
 
. : . : . : . : . : . :
rJMSF050H05+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
rJMSF016I05+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
rJMFF001C24+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
rJMFF016O22+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
rJMFF032M13+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
rJMFF016E22+ CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
                      ____________________________________________________________
consensus CTTTGTTGTAGTTATTTCTCGTGACGTTTCAGTTTATTGTGGACCCGGACCTGGACCTGG
 
. : . : . : . : . : . :
rJMSF050H05+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
rJMSF016I05+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
rJMFF001C24+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
rJMFF016O22+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
rJMFF032M13+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
rJMFF016E22+ GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
                      ____________________________________________________________
consensus GGTGCCCCTCCATTTCCCCATCGGCCTGCTCTGTTTGGCTTGCTAAAACTTGGAGGTCTC
 
. : . : . : . : . : . :
rJMSF050H05+ TTTCGTACTTTAAAACTACTAAACTATAT-CTGTCTTTGACTT
rJMSF016I05+ TTTCGTACTTT-AAACTACTAAACTATATCCTGTCTTTGACTT
rJMFF001C24+ TTTCGTACTTT-AAACTACTAAACTATAT-CTGTCTTTGACTTA
rJMFF016O22+ TTTCGTACTTT-AAACTACTAAACTATAT-CTGTCTTTGACTTA
rJMFF032M13+ TTTCGTACTTT-AAACTACTAAACTATAT-CTGTCTTTGACTTA
rJMFF016E22+ TTTCGTACTTT-AAACTACTAAACTATAT-CTGTCTTTGACTTATGTGATTAAGCTCAAC
                      ____________________________________________________________
consensus TTTCGTACTTT-AAACTACTAAACTATAT-CTGTCTTTGACTTATGTGATTAAGCTCAAC