Previous Contig 008935:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L19Sequence585006913 (14)gb:AY084427_15695171e-23Arabidopsis thaliana clone 108109 mRNA, complete sequence.622008935 (12)gb:AC087181_17339352e-21Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF001H24Sequence283006913 (14)752008935 (12)gb:AC087181_17339351e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF003I08Sequence327006913 (14)gb:AP004888_18466773e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P061787008935 (12)gb:AC087181_17339351e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF012A02Sequence477006913 (14)gb:AP004888_18466779e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P061661008935 (12)gb:AC087181_17339354e-28Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF014E09Sequence267006913 (14)720008935 (12)gb:AC087181_17339352e-29Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF022F24Sequence638006913 (14)gb:BT015778_16423963e-24Arabidopsis thaliana At1g25440 mRNA, complete cds.747008935 (12)gb:AC087181_17339354e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF027O04Sequence637006913 (14)gb:BT015778_16423963e-24Arabidopsis thaliana At1g25440 mRNA, complete cds.686008935 (12)gb:AC087181_17339351e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF028P14Sequence623006913 (14)gb:BT015778_16423963e-24Arabidopsis thaliana At1g25440 mRNA, complete cds.710008935 (12)gb:AY054625_15632794e-33Arabidopsis thaliana putative B-box zinc finger protein (At1g68520; T26J14.9) mR
JMSF033E24Sequence687006913 (14)gb:BT015778_16423962e-25Arabidopsis thaliana At1g25440 mRNA, complete cds.746008935 (12)gb:AC087181_17339357e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF033N13Sequence639006913 (14)gb:BT015778_16423967e-24Arabidopsis thaliana At1g25440 mRNA, complete cds.652008935 (12)gb:BT015778_16423962e-18Arabidopsis thaliana At1g25440 mRNA, complete cds.
JMSF042C10Sequence750006913 (14)gb:BT015778_16423963e-26Arabidopsis thaliana At1g25440 mRNA, complete cds.795008935 (12)gb:AC087181_17339351e-30Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.
JMSF052D13Sequence697006913 (14)gb:BT015778_16423968e-27Arabidopsis thaliana At1g25440 mRNA, complete cds.940008935 (12)gb:AC087181_17339352e-31Oryza sativa chromosome 3 BAC OSJNBa0018H01 genomic sequence, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF028P14+ TCGGA
                      ____________________________________________________________
consensus TCGGA
 
. : . : . : . : . : . :
rJMSF028P14+ CGTGGAGTTGGCGGAGTTCGCTGCCGACGTAGAGACGTTGTTAGGAGACGATGATGTTGG
rJMSF052D13+ TGGAGTNGGCGGAGTTCGCTGCCGACGTAGAGACGTTGTTAGGAGACGATGATGTTGG
                      ____________________________________________________________
consensus CGTGGAGTTGGCGGAGTTCGCTGCCGACGTAGAGACGTTGTTAGGAGACGATGATGTTGG
 
. : . : . : . : . : . :
rJMSF028P14+ GGAAGACAAAGCGACGGCGGCGGTGAAGATTGAGATTAATGGGGGCGATTGTACGGAGGC
rJMSF052D13+ GGAAGACAAAGCGACGGCGGCNGTGAAGATTGAGATTAATGGGGGCGATTGTACGGAGGC
                      ____________________________________________________________
consensus GGAAGACAAAGCGACGGCGGCGGTGAAGATTGAGATTAATGGGGGCGATTGTACGGAGGC
 
. : . : . : . : . : . :
rJMSF028P14+ GTTGAATTGGAGTTTTGGGGAAGAGCAGGAAGTTGAGCAG-AAAGTGATGATGACGATGT
rJMSF042C10+ GAAGAGCAGGAAGTTGAGCAGNAAAGTGATGATGACGATGT
rJMSF003I08+ AGCAGGAAGNTGAGCAG-AAAGTGATGATGACGATGT
rJMSF022F24+ TGGAGTTTTGGGGAAGAGCAGGAAGTTGAGCAG-AGAGTGATGATGACGATGT
rJMSF001H24+ TGGAGTTTT-GGGAAGAGCAGGAAGTTGAGCAG-AAAGTGATGATGACGATGT
rJMSF033E24+ GGAGTTTTGGGGAAGAGCNGGAAGTTGAGCNG-AAAGTGATGATGACGATGT
rJMSF052D13+ GTTGAATTGGAGTTTTGGGGAAGAGCAGGAAGTTGAGCAG-AAAGTGATGATGACGATGT
                      ____________________________________________________________
consensus GTTGAATTGGAGTTTTGGGGAAGAGCAGGAAGTTGAGCAG-AAAGTGATGATGACGATGT
 
. : . : . : . : . : . :
rJMSF028P14+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF014E09+ AAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF042C10+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF003I08+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF022F24+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF027O04+ TGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF001H24+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
rJMSF033E24+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAA-AGAAAGTGG
rJMSF052D13+ TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
                      ____________________________________________________________
consensus TGAGTGGATTTGATGAGTCGTCGTCGTCCATGGAAAGTGGAAGCTGTAAAGAAGAAGTGG
 
. : . : . : . : . : . :
rJMSF028P14+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF014E09+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTNGGGCTA
rJMSF042C10+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF012A02+ ACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF003I08+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF022F24+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF027O04+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF001H24+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF033E24+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
rJMSF052D13+ CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
                      ____________________________________________________________
consensus CGAAGAAGTCGAGGATGCTTTTAAGTCTTAACTACGAGGAAGTTATCAGTGCTTGGGCTA
 
. : . : . : . : . : . :
rJMSF028P14+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF014E09+ GCCAAGGTTGTCCCTGGACNGATGGAACTCGACCCCATTTCGACCCAAACCANTGCTGGC
rJMSF042C10+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF012A02+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF003I08+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF022F24+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF027O04+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF001H24+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF033E24+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMSF052D13+ GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
rJMFF015L19+ TTCGACCCAAACCATTGCTGGC
                      ____________________________________________________________
consensus GCCAAGGTTGTCCCTGGACTGATGGAACTCGACCCCATTTCGACCCAAACCATTGCTGGC
 
. : . : . : . : . : . :
rJMSF028P14+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF014E09+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF042C10+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF012A02+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF033N13+ GGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF003I08+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF022F24+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF027O04+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF001H24+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF033E24+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMSF052D13+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
rJMFF015L19+ CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTNTGCAATGATGATGA
                      ____________________________________________________________
consensus CAGATTTCATGGGAGGAGATCATCATCATCATCATCCATACGGGTCTGCAATGATGATGA
 
. : . : . : . : . : . :
rJMSF028P14+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF014E09+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF042C10+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF012A02+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF033N13+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF003I08+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF022F24+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF027O04+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF001H24+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF033E24+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMSF052D13+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
rJMFF015L19+ GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
                      ____________________________________________________________
consensus GACGAAGCGACGAAGGGAGAGAAGCACGGGTGAGTCGATACAGGGAGAAGAGGAGGACGA
 
. : . : . : . : . : . :
rJMSF028P14+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF014E09+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF042C10+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF012A02+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF033N13+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF003I08+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF022F24+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF027O04+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF001H24+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF033E24+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMSF052D13+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
rJMFF015L19+ GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
                      ____________________________________________________________
consensus GGTTGTTCTCAAAGAAAATTCGGTACGAGGTGAGGAAATTGAATGCAGAGAAGAGGCCTC
 
. : . : . : . : . : . :
rJMSF028P14+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF014E09+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF042C10+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF012A02+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF033N13+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF003I08+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF022F24+ GTTTGAAAGGGCGGTTTGTGGAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF027O04+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF001H24+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF033E24+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMSF052D13+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
rJMFF015L19+ GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
                      ____________________________________________________________
consensus GTTTGAAAGGGCGGTTTGTGAAGAGGTCATCATTGTTTCAGCCACCGCCGCCCTTCCCCA
 
. : . : . : . : . : . :
rJMSF028P14+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF014E09+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF042C10+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF012A02+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF033N13+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF003I08+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF022F24+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF027O04+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF001H24+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF033E24+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMSF052D13+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
rJMFF015L19+ ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
                      ____________________________________________________________
consensus ACTACCTCCTCAATCGACATTTATGAATTGATGAAGGTCGAATTCAACAACTTTATGAGA
 
. : . : . : . : . : . :
rJMSF028P14+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCAT
rJMSF014E09+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF042C10+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF012A02+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF033N13+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF003I08+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF022F24+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF027O04+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF001H24+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF033E24+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMSF052D13+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
rJMFF015L19+ TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
                      ____________________________________________________________
consensus TATATATTAATTAATGTTACATATATGGAATCTGGGATATTGCCATATTGGATTACAATC
 
. : . : . : . : . : . :
rJMSF014E09+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF042C10+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF012A02+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF033N13+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF003I08+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF022F24+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF027O04+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF001H24+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF033E24+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMSF052D13+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
rJMFF015L19+ CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
                      ____________________________________________________________
consensus CACACTAATTAAACCTAGGTTTTTTTCCCTATGACTAATCATTCAGTCATGGTGATGCAA
 
. : . : . : . : . : . :
rJMSF014E09+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTNTTAT
rJMSF042C10+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF012A02+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF033N13+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF003I08+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF022F24+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF027O04+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF001H24+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF033E24+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMSF052D13+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
rJMFF015L19+ GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
                      ____________________________________________________________
consensus GATATATATATTTATATATATGTGGGCATAACTTAGGGGAGTTTGGCTCATAACTTTTAT
 
. : . : . : . : . : . :
rJMSF014E09+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMSF042C10+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMSF012A02+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMSF033N13+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMSF003I08+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMSF022F24+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACT
rJMSF027O04+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTT
rJMSF001H24+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTT
rJMSF033E24+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTT
rJMSF052D13+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
rJMFF015L19+ TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
                      ____________________________________________________________
consensus TCTCTGATGTATCTTCGGATTCGTTTCCGATTACTTTGTTTTGACTATTTTTGTAATAGC
 
. : . : . : . : . : . :
rJMSF014E09+ AAAAGTNTATTGCCCGCTATGCCAAAAGGGGTG
rJMSF042C10+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGGTG
rJMSF012A02+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGG
rJMSF033N13+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGG
rJMSF003I08+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGG
rJMSF052D13+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGGTG-TGTAAAATAT
rJMFF015L19+ AAAAGTTTATTGCCCGCTATGCCAAAAGGGGTGTTGTAAAATATTAGTAAAATTAACATT
                      ____________________________________________________________
consensus AAAAGTTTATTGCCCGCTATGCCAAAAGGGGTGTTGTAAAATATTAGTAAAATTAACATT