Previous Contig 008932:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007J01Sequence493008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.465008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFF015K18Sequence493008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.486008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFF016J10Sequence496008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.501021025gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFF023O08Sequence494008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.470008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFF045O08Sequence482008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.506008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN005L11Sequence565008932 (47)gb:AF242374_17801513e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN009M06Sequence463008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN017A01Sequence631008932 (47)gb:AF242374_17801514e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN025J18Sequence513008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN039G20Sequence489008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFN039K10Sequence452008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS008A07Sequence463008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS009A01Sequence450008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS038H11Sequence438008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS044D10Sequence310008932 (47)gb:AF242374_17801515e-09Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS048G12Sequence423008932 (47)gb:AF242374_17801519e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS052G05Sequence410008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS055C04Sequence462008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS073F02Sequence454008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS099E02Sequence449008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS101B01Sequence454008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS135A12Sequence458008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMFS156E06Sequence468008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF002G13Sequence448008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.434008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF007C10Sequence277008932 (47)gb:AF242374_17801511e-28Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.436008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF011B15Sequence251008932 (47)gb:AF242374_17801511e-26Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.438008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF017A22Sequence437008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.437008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF023P01Sequence492008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.439008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF026J09Sequence490008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.441008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF027C05Sequence514008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.438008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF028H06Sequence454008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF037F24Sequence492008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.435008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF039F24Sequence419000016 (73)sp|P77214|CUSF_ECOLI8e-48Cation efflux system protein cusF precursor.>pir|C64790|C64790 yclC protein - Es437008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.
JMSF043A23Sequence492008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.435008932 (47)gb:AF242374_17801512e-29Ipomoea batatas metallothionein-like protein (SPMT) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN017A01+ AATTATTTAAAGTGAGCAGATTTTA
                      ____________________________________________________________
consensus AATTATTTAAAGTGAGCAGATTTTA
 
. : . : . : . : . : . :
JMFN017A01+ TTGACATTTGACTTTATTNTCTGAGTCATTAAGTTACCGTGCAATTCTCTAAATGTTATG
                      ____________________________________________________________
consensus TTGACATTTGACTTTATTNTCTGAGTCATTAAGTTACCGTGCAATTCTCTAAATGTTATG
 
. : . : . : . : . : . :
JMFN017A01+ TCGGATCAGGGTGTTGGGGGCCTTTGGAATTGGGGGTTCAACCTTTTAGGAAAAGAAGTA
                      ____________________________________________________________
consensus TCGGATCAGGGTGTTGGGGGCCTTTGGAATTGGGGGTTCAACCTTTTAGGAAAAGAAGTA
 
. : . : . : . : . : . :
JMFN017A01+ TAGCAAGTGGATATGGAAGACAGGGCGATATATAACCTTAATTACTACTTATCCATTTAA
JMFF007J01+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
JMSF043A23+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
JMFN009M06+ TATAACCTTAATTACTACTTATCCATTTAA
JMSF037F24+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
JMSF026J09+ TTTTTTTTTTAACCTTAATTACTACTTATCCATTTAA
JMFF023O08+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
rJMFF045O08- ATAACCTTAATTACTACTTATCCATTTAA
JMFS156E06+ ATAACCTTAATTACTACTTATCCATTTAA
JMFS008A07- AACCTTAATTACTACTTATCCATTTAA
rJMFF007J01- TTATCCATTTAA
JMFS055C04+ AACCTTAATTACTACTTATCCATTTAA
JMFS073F02+ AACCTTAATTACTACTTATCCATTTAA
JMFF045O08+ ATAACCTTAATTACTACTTATCCATTTAA
JMSF027C05+ ATAACCTTAATTACTACTTATCCATTTAA
JMSF023P01+ ATAACCTTAATTACTACTTATCCATTTAA
JMFN025J18- AACCTTAATTACTACTTATCCATTTAA
JMFS135A12+ ATAACCTTAATTACTACTTATCCATTTAA
JMFN039G20- AACCTTAATTACTACTTATCCATTTAA
JMFS101B01+ ATAACCTTAATTACTACTTATCCATTTAA
JMFN039K10+ ATAACCTTAATTACTACTTATCCATTTAA
JMFS009A01+ ATAACCTTAATTACTACTTATCCATTTAA
JMFS099E02+ ATAACCTTAATTACTACTTATCCATTTAA
JMFS038H11+ AACCTTAATTACTACTTATCCATTTAA
JMFN005L11+ AACCTTAATTACTACTTATCCATTTAA
JMFS052G05+ ATAACCTTAATTACTACTTATCCATTTAA
JMFS048G12+ AACCTTAATTACTACTTATCCATTTAA
JMFS044D10+ ATAACCTTAATTACTACTTATCCATTTAA
JMFF015K18+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
JMFF016J10+ TTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
rJMFF015K18- TTATCCATTTAA
                      ____________________________________________________________
consensus TAGCAAGTGGATATGGAAGACTTTTTTTTTTATAACCTTAATTACTACTTATCCATTTAA
 
. : . : . : . : . : . :
JMFN017A01+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFF007J01+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACACCCATATTGAA
rJMSF043A23- TAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF043A23+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFN009M06+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF037F24+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF026J09- GTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF026J09+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFF023O08+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACACCCATATTGAA
rJMFF045O08- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS156E06+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS008A07- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMFF007J01- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS055C04+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS073F02+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF002G13+ ACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF011B15- ACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF027C05- CGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF037F24- TAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF007C10- GTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF002G13- GTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF039F24- GTAAGAGTACA-GAGGAGACA-GACAGCCACA-CCATATTGAA
rJMSF028H06- ACAACGTAAGAGTACA-GAGCAGACA-GACAGCCACA-CCATATTGAA
JMFF045O08+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF027C05+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF023P01- GAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMSF023P01+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFN025J18- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS135A12+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFN039G20- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS101B01+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFN039K10+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS009A01+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS099E02+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS038H11+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMSF017A22- GTAAGAGTACAGGAG-AGACAGGACAGCCACA-CCATATTGAA
JMSF017A22+ ACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFN005L11+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS052G05+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS048G12+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFS044D10+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
JMFF015K18+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACACCCATATTGAA
JMFF016J10+ AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACACCCATATTGAA
rJMFF023O08- AAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
rJMFF015K18- AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
                      ____________________________________________________________
consensus AACACAAAGTGAACAACGTAAGAGTACA-GAG-AGACA-GACAGCCACA-CCATATTGAA
 
. : . : . : . : . : . :
JMFN017A01+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFF007J01+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF043A23- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF043A23+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFN009M06+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF037F24+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF026J09- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF026J09+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFF023O08+ CCTACATACTTATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMFF045O08- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS156E06+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS008A07- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMFF007J01- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS055C04+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS073F02+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF002G13+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF011B15- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF027C05- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF037F24- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF007C10- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF002G13- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF039F24- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF028H06- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFF045O08+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF027C05+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF023P01- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF023P01+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFN025J18- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS135A12+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFN039G20- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS101B01+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFN039K10+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS009A01+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS099E02+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS038H11+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMSF017A22- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMSF017A22+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFN005L11+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS052G05+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS048G12+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFS044D10+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFF015K18+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
JMFF016J10+ CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMFF023O08- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
rJMFF015K18- CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
                      ____________________________________________________________
consensus CCTACATAC-TATGACATGCTACAACACAGTACACAAATTATTTCATCACAACTTATTTA
 
. : . : . : . : . : . :
JMFN017A01+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFF007J01+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF043A23- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF043A23+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFN009M06+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF037F24+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF026J09- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGGTTTCTG
JMSF026J09+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGGTTTCTG
JMFF023O08+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACGTGTATGGCTGTTGATTTCTG
rJMFF045O08- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS156E06+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS008A07- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMFF007J01- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS055C04+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS073F02+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF002G13+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF011B15- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF027C05- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF037F24- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF007C10- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF002G13- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF039F24- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF028H06- TTACATCATAGTATAAGGATTTTGGAAACTTANAATCACATGTATGGCTGTTGATTTCTG
JMFF045O08+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF027C05+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF023P01- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF023P01+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFN025J18- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS135A12+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFN039G20- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS101B01+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFN039K10+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS009A01+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS099E02+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS038H11+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMSF017A22- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMSF017A22+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFN005L11+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS052G05+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS048G12+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFS044D10+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFF015K18+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
JMFF016J10+ TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
rJMFF023O08- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACGTGTATGGCTGTTGATTTCTG
rJMFF015K18- TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
                      ____________________________________________________________
consensus TTACATCATAGTATAAGGATTTTGGAAACTTAGAATCACATGTATGGCTGTTGATTTCTG
 
. : . : . : . : . : . :
JMFN017A01+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFF007J01+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF043A23- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF043A23+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFN009M06+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF037F24+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF026J09- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF026J09+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFF023O08+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMFF045O08- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS156E06+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS008A07- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMFF007J01- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS055C04+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS073F02+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF002G13+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF011B15- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF027C05- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF037F24- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF007C10- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF002G13- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF039F24- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF028H06- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFF045O08+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF027C05+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF023P01- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF023P01+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFN025J18- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS135A12+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFN039G20- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS101B01+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFN039K10+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS009A01+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS099E02+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS038H11+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMSF017A22- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF017A22+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFN005L11+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS052G05+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS048G12+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFS044D10+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMSF007C10+ TGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTNGGCTCCGCACTTGC
JMSF011B15+ AGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFF015K18+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
JMFF016J10+ CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMFF023O08- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
rJMFF015K18- CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
                      ____________________________________________________________
consensus CTGTCTGCACTTAGTGGCCACAAGTGCAGTCGGTACAGCTGCAGTTGGCTCCGCACTTGC
 
. : . : . : . : . : . :
JMFN017A01+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFF007J01+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF043A23- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF043A23+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFN009M06+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF037F24+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF026J09- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF026J09+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFF023O08+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMFF045O08- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS156E06+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS008A07- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMFF007J01- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS055C04+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS073F02+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF002G13+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF011B15- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF027C05- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF037F24- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF007C10- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF002G13- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF039F24- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF028H06- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFF045O08+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF027C05+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF023P01- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF023P01+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFN025J18- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS135A12+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFN039G20- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS101B01+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFN039K10+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS009A01+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS099E02+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS038H11+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMSF017A22- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF017A22+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFN005L11+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS052G05+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS048G12+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFS044D10+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTA
JMSF007C10+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMSF011B15+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFF015K18+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
JMFF016J10+ AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMFF023O08- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
rJMFF015K18- AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
                      ____________________________________________________________
consensus AACCATTCTCAGCTGCTGCAACATCCATCACTATGCTCTCAGTGTAGCTCTTCTCAGTCA
 
. : . : . : . : . : . :
JMFN017A01+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFF007J01+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF043A23- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF043A23+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFN009M06+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF037F24+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF026J09- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF026J09+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFF023O08+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMFF045O08- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS156E06+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS008A07- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMFF007J01- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS055C04+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS073F02+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF002G13+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF011B15- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF027C05- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF037F24- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF007C10- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF002G13- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF039F24- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF028H06- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFF045O08+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF027C05+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF023P01- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF023P01+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFN025J18- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS135A12+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFN039G20- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS101B01+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFN039K10+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS009A01+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS099E02+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS038H11+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMSF017A22- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF017A22+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFN005L11+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS052G05+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFS048G12+ CAAAAATAACGTCGTCCATCNTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF007C10+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMSF011B15+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFF015K18+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
JMFF016J10+ CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMFF023O08- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
rJMFF015K18- CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
                      ____________________________________________________________
consensus CAAAAATAACGTCGTCCATCTTGTTTCCCTTCTTCGTGCACTGGGTGGAATCAGCGCAGT
 
. : . : . : . : . : . :
JMFN017A01+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFF007J01+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF043A23- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF043A23+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFN009M06+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF037F24+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF026J09- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF026J09+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFF023O08+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMFF045O08- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS156E06+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS008A07- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMFF007J01- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS055C04+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS073F02+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF002G13+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF011B15- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF027C05- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF037F24- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF007C10- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF002G13- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF039F24- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF028H06- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFF045O08+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF027C05+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMSF023P01- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF023P01+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFN025J18- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS135A12+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFN039G20- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS101B01+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFN039K10+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS009A01+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS099E02+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFS038H11+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGC
rJMSF017A22- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF017A22+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFN005L11+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAA
JMFS052G05+ CGCAGTTTCCGCACTTGTCCGACATG
JMFS048G12+ CGCAGTTTCCGCACTTGTCCGACATGG
JMSF007C10+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMSF011B15+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFF015K18+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
JMFF016J10+ CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMFF023O08- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
rJMFF015K18- CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
                      ____________________________________________________________
consensus CGCAGTTTCCGCACTTGTCCGACATGGTAGACGATTAAGGGCAACTAACAACTTGCTTAC
 
. : . : . : . : . : . :
JMFN017A01+ AACAATGGGTT
JMFF007J01+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
rJMSF043A23- AACAATGGGTTTTCTCGGAAGATCTTAGGATGCCTGC
JMSF043A23+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGCCTGC
JMFN009M06+ AACAATGGGTTTTCTCG
JMSF037F24+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
rJMSF026J09- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMSF026J09+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMFF023O08+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
rJMFF045O08- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMFS156E06+ AACAATGGGTTTTCTCGGAAGATC
JMFS008A07- AACAATGGGTTTTCTCGGAAG
rJMFF007J01- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
JMFS055C04+ AACAATGGGTTTTCTCGGAA
JMFS073F02+ AACAATGGGTTT
JMSF002G13+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
rJMSF011B15- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
rJMSF027C05- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGT
rJMSF037F24- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
rJMSF007C10- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
rJMSF002G13- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
rJMSF039F24- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
rJMSF028H06- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTG
JMFF045O08+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMSF027C05+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGT
rJMSF023P01- AACAATGGGTTTTCTCGGAAGATTTTAGGATGTCTGTC
JMSF023P01+ AACAATGGGTTTTCTCGGAAGATTTTAGGATGTCTGTC
JMFN025J18- AACAATGGGTTTTCTCGGA
JMFS135A12+ AACAATGGGTTTTC
JMFN039G20- AACAATGGGTTTT
JMFS101B01+ AACAATGGGT
JMFN039K10+ AACAATGG
JMFS009A01+ AACAAT
JMFS099E02+ AACAA
rJMSF017A22- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGC
JMSF017A22+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGC
JMSF007C10+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCT
JMSF011B15+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMFF015K18+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTC
JMFF016J10+ AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTCTC
rJMFF023O08- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTCTCGCTGTTCCAGACAGCGATGA
rJMFF015K18- AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTCTCGCTGTT-TAGACAGCGATGA
                      ____________________________________________________________
consensus AACAATGGGTTTTCTCGGAAGATCTTAGGATGTCTGTCTCGCTGTTCTAGACAGCGATGA