Previous Contig 008931:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015J20Sequence532007025 (2)gb:AY123847_15800566e-35Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle680008931 (4)gb:AY123847_15800562e-56Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle
JMSF019C07Sequence765008931 (4)gb:AY123847_15800569e-91Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle
JMSF035H14Sequence646007025 (2)gb:AY123847_15800561e-46Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle726008931 (4)gb:AY123847_15800563e-82Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle
JMSF048L24Sequence670007862 (3)gb:GMJ004899_16804977e-46Glycine max mRNA for rudimentary enhancer, partial.698008931 (4)gb:AY123847_15800565e-84Nicotiana tabacum glutamate/malate translocator (DiT2) mRNA, complete cds; nucle

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF019C07+ TGAATGGACAATGATTGGAACAATGCTTCTTGCTGTCT
                      ____________________________________________________________
consensus TGAATGGACAATGATTGGAACAATGCTTCTTGCTGTCT
 
. : . : . : . : . : . :
rJMSF048L24+ GGGGATGCACTNGGCATCGCAAGTGTTGTTGCTGCCATGCTTGGGT
rJMSF019C07+ CCTTGTGGGGTTTNGGGGATGCACNTGGCATCGCAAGTGTTGTTGCTGCCATNCNTGGGT
                      ____________________________________________________________
consensus CCTTGTGGGGTTTNGGGGATGCACTTGGCATCGCAAGTGTTGTTGCTGCCATGCTTGGGT
 
. : . : . : . : . : . :
rJMSF048L24+ TATCGATTCTCTTGTTGTTAGGAGTGCTTGATTGGGATGACTGCTTAAGTGAAAAATCCG
rJMSF019C07+ TATCGATTCTCTTGTTGTTAGGAGTGCTTGATTGGGATGACTGCTTAAGTGAAAAATCCG
rJMSF035H14+ GTTAGGAGTGCTTGATT-GGATGACTGCTTAAGTGAAAAATCCG
                      ____________________________________________________________
consensus TATCGATTCTCTTGTTGTTAGGAGTGCTTGATTGGGATGACTGCTTAAGTGAAAAATCCG
 
. : . : . : . : . : . :
rJMSF048L24+ CTTGGGATACTCTGGCATGGTTTGCAGTTCTAGTGGGCATGGCAAGCCAGTTGACTAACC
rJMSF019C07+ CTTGGGATACTCTGGCATGGTTTGCAGTTNTAGTGGGCATGGCAAGCCAGTTGACTAACC
rJMSF035H14+ CTTGGGATACTCTGGCATGGTTTGCAGTTCTAGTGGGCATGGCAAGCCAGTTGACTAACC
                      ____________________________________________________________
consensus CTTGGGATACTCTGGCATGGTTTGCAGTTCTAGTGGGCATGGCAAGCCAGTTGACTAACC
 
. : . : . : . : . : . :
rJMSF048L24+ TTGGAATTGTTAGTTGGATGTCTAACTGTGTAGCGAAGTCTCTTCAATGTTTATCATTGA
rJMSF019C07+ TTGGAATTGTTAGTTGGATGTCTAACTGTGTAGCGAAGTCTCTTCAATGTTTATCATTGA
rJMSF035H14+ TTGGAATTGTTAGTTGGATGTCTAACTGTGTAGCGAAGTCTCTTCAATGTTTATCATTGA
rJMFF015J20+ TCTTCAATGTTTATCATTGA
                      ____________________________________________________________
consensus TTGGAATTGTTAGTTGGATGTCTAACTGTGTAGCGAAGTCTCTTCAATGTTTATCATTGA
 
. : . : . : . : . : . :
rJMSF048L24+ GCTGGCCAGCTGCGTTTCTCATACTTCAAGCATCTTACTTCTGTATCCACTACCTATTTG
rJMSF019C07+ GCTGGCCAGCTGCGTTTCTCATACTTCAAGCATCTTACTTCTGTATCCACTACCTATTTG
rJMSF035H14+ GCTGGCCAGCTGCGTTTCTCATACTTCAAGCATCTTACTTCTGTATCCACTACCTATTTG
rJMFF015J20+ GCTGNCCAGCTGCGTTTCTCATACTTCAAGCATCTTACTTCTGTATCCACTACCTATTTG
                      ____________________________________________________________
consensus GCTGGCCAGCTGCGTTTCTCATACTTCAAGCATCTTACTTCTGTATCCACTACCTATTTG
 
. : . : . : . : . : . :
rJMSF048L24+ CAAGCCAAACTGGCCACGTGGGAGCATTATACTCCGCATTCCTTGCTATGAATTTAGCCT
rJMSF019C07+ CAAGCCAAACTGGCCACGTGGGAGCATTATACTCCGCATTCCTTGCTATGAATTTAGCCT
rJMSF035H14+ CAAGCCAAACTGGCCACGTGGGAGCATTATACTCCGCATTCCTTGCTATGAATTTAGCCT
rJMFF015J20+ CAAGCCAAACTGGCCACGTGGGAGCATTATACTCCGCATTCCTTGCTATGAATTTAGCCT
                      ____________________________________________________________
consensus CAAGCCAAACTGGCCACGTGGGAGCATTATACTCCGCATTCCTTGCTATGAATTTAGCCT
 
. : . : . : . : . : . :
rJMSF048L24+ CTGGAGTGCCTGGTGTTTTAGCAGCATTGGGTTTGGCGTATAATACTAACCTGTTTGGTG
rJMSF019C07+ NTGGAGTGCCTGGTGTTTTAGCAGCATTGGGTTTGGCGTATAATACTAACCTGTTTGGTG
rJMSF035H14+ CTGGAGTGCCTGGTGTTTTAGCAGCATTGGGTTTGGCGTATAATACTAACCTGTTTGGTG
rJMFF015J20+ CTGGAGTGCCTGGTGTTTTAGCAGCATTGGGTTTGGCGTATAATACTAACCTGTTTGGTG
                      ____________________________________________________________
consensus CTGGAGTGCCTGGTGTTTTAGCAGCATTGGGTTTGGCGTATAATACTAACCTGTTTGGTG
 
. : . : . : . : . : . :
rJMSF048L24+ CTTTGACACATTATAGCAGTGGTCAAGCTGCTGTTTACTTTGGAGCTGGGTATGTAGATC
rJMSF019C07+ CTTTGACACATTATAGCAGTGGTCAAGCTGCTGTTTACTTTGGAGCTGGGTATGTAGATC
rJMSF035H14+ CTTTGACACATTATAGCAGTGGTCAAGCTGCTGTTTACTTTGGAGCTGGGTATGTAGATC
rJMFF015J20+ CTTTGACACATTATAGCAGTGGTCAAGCTGCTGTTTACTTTGGAGCTGGGTATGTAGATC
                      ____________________________________________________________
consensus CTTTGACACATTATAGCAGTGGTCAAGCTGCTGTTTACTTTGGAGCTGGGTATGTAGATC
 
. : . : . : . : . : . :
rJMSF048L24+ TCCCGGATGTGTTCAAATTTGGATTTATAATGGCTGTCATCAATGCATTAATTTGGGGAG
rJMSF019C07+ TCCCGGATGTGTTCAAATTTGGATTTATAATGGCTGTCATCAATGCATTAATTTGGGGAG
rJMSF035H14+ TCCCGGATGTGTTCAAATTTGGATTTATAATGGCTGTCATCAATGCATTAATTTGGGGAG
rJMFF015J20+ TCCCGGATGTGTTCAAATTTGGATTTATAATGGCTGTCATCAATGCATTAATTTGGGGAG
                      ____________________________________________________________
consensus TCCCGGATGTGTTCAAATTTGGATTTATAATGGCTGTCATCAATGCATTAATTTGGGGAG
 
. : . : . : . : . : . :
rJMSF048L24+ TTGTTGGCACTTTCTGGTGGAAGTTCCTGGGGCTATACTGAGTTAAATTCATGCAGGCAG
rJMSF019C07+ TTGTTGGCACTTTCTGGTGGAAGTTCCTGGGGCTATACTGAGNTAAATTCATGCAGGCAG
rJMSF035H14+ TTGTTGGCACTTTCTGGTGGAAGTTCCTGGGGCTATACTGAGTTAAATTCATGCAGGCAG
rJMFF015J20+ TTGTTGGCACTTTCTGGTGGAAGTTCCTGGGGCTATACTGAGTTAAATTCATGCAGGCAG
                      ____________________________________________________________
consensus TTGTTGGCACTTTCTGGTGGAAGTTCCTGGGGCTATACTGAGTTAAATTCATGCAGGCAG
 
. : . : . : . : . : . :
rJMSF048L24+ GCCATGTAAGTAGAATTTTCCCCGCAAATTCCTTCTCCCCGCTTTGTCATAGATAGCTGC
rJMSF019C07+ GCCATGTAAGTAGAATTTTCCCCGCAAATTCCTTCTCCCCGCTTTGTCATAGATAGCTGC
rJMSF035H14+ GCCATGTAAGTAGAATTTTCCCCGCAAATTCCTTCTCCCCGCTTTGTCATAGATAGCTGC
rJMFF015J20+ GCCATGTAAGTAGAATTTTCCCCGCAAATTCCTTCTCCCCGCTTTGTCATAGATAGCTGC
                      ____________________________________________________________
consensus GCCATGTAAGTAGAATTTTCCCCGCAAATTCCTTCTCCCCGCTTTGTCATAGATAGCTGC
 
. : . : . : . : . : . :
rJMSF048L24+ TAGCAACAGCAAGTCTTTCACATACTAGTGAAAAAGTTGGCGAGGCAT
rJMSF019C07+ TAGCAACAGCAAGTCTTTCACATACTAGTGAAAAAGTTGGCGAGGCATNCCCATTTTCAG
rJMSF035H14+ TAGCAACAGCAAGTCTTTCACATACTAGTGAAAAAGTTGGCGAGGCATTCCCATTTTCAG
rJMFF015J20+ TAGCAACAGCAAGTCTTTCACATACTAGTGAAAAAGTTGGCGAGGCATTCCCATTTTCAG
                      ____________________________________________________________
consensus TAGCAACAGCAAGTCTTTCACATACTAGTGAAAAAGTTGGCGAGGCATTCCCATTTTCAG
 
. : . : . : . : . : . :
rJMSF019C07+ AAATAAT
rJMSF035H14+ AAATAATTTACAGCTAATATTTTTCTTGGCACTCTGATGGATATGATGAAATTCAA-TTT
rJMFF015J20+ AAATAATTTACAGCTAATATTTTTCTTGGCACTCTGATGGATATGATGAAATTCAATTTT
                      ____________________________________________________________
consensus AAATAATTTACAGCTAATATTTTTCTTGGCACTCTGATGGATATGATGAAATTCAATTTT
 
. : . : . : . : . : . :
rJMSF035H14+ TGGAGGAGAGAATCAGAGAGT
rJMFF015J20+ TGGAGGAGAGAATCAGAGAGTTGACATTTATAAAATGAACATATTCTTTTGCAGTTTATT
                      ____________________________________________________________
consensus TGGAGGAGAGAATCAGAGAGTTGACATTTATAAAATGAACATATTCTTTTGCAGTTTATT
 
. : . : . : . : . : . :
rJMFF015J20+ GATGGTTTCTTTAGTTGGGACTATTAAAGCTAGAAAGAATGATATTCTGTTTGATTGCAT
                      ____________________________________________________________
consensus GATGGTTTCTTTAGTTGGGACTATTAAAGCTAGAAAGAATGATATTCTGTTTGATTGCAT