Previous Contig 008929:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014B16Sequence558000801 (4)292008929 (4)
JMFF015J04Sequence548000801 (4)746008929 (4)
JMFF029F17Sequence564000801 (4)718008929 (4)
JMFF040H09Sequence491000801 (4)719008929 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF040H09+ CCAAGAAGAAAGTATCCAAA
rJMFF015J04+ CAACCCCCAAGAAGAAAGTATCCAAA
                      ____________________________________________________________
consensus CAACCCCCAAGAAGAAAGTATCCAAA
 
. : . : . : . : . : . :
rJMFF040H09+ GTGAAGAAAGAACATAAGGAATCCTGGTCTATGCCCAGTGATTTTGTTAAGACGCGGAGG
rJMFF029F17+ GAAGAAAGACCATAAGGAATCCTGGTCTATGCCCAGTGATTTTGTTAAGACGCGGAGG
rJMFF015J04+ GTGAAGAAAGAACATAAGGAATCNTGGTCTATGCCCAGTGATTTTGTTAAGACGCGGAGG
                      ____________________________________________________________
consensus GTGAAGAAAGAACATAAGGAATCCTGGTCTATGCCCAGTGATTTTGTTAAGACGCGGAGG
 
. : . : . : . : . : . :
rJMFF040H09+ AATAAAGCAAAATATGAAGGTGACTATACATCAGGGTACAAAACAAAACGAAGGGGAGGT
rJMFF029F17+ AATAAAGCAAAATATGAAGGTGACTATACATCAGGGTACAAAACAAAACGAAGGGGAGGT
rJMFF015J04+ AATAAAGCAAAATATGAAGGTGACTATACATCAGGGTACAAAACAAAACGAAGGGGAGGT
                      ____________________________________________________________
consensus AATAAAGCAAAATATGAAGGTGACTATACATCAGGGTACAAAACAAAACGAAGGGGAGGT
 
. : . : . : . : . : . :
rJMFF040H09+ TGGATCATGGATGACCCGGAAGACTACTCAGAACCCAAAGGATTTGCAAGTCCTGTAACT
rJMFF029F17+ TGGATCATGGATGACCCGGAAGACTACTCAGAACCCAAAGGATTTGCAAGTCCTGTAACT
rJMFF015J04+ TGGATCATGGATGACCCGGAAGACTACTCAGAACCCAAAGGATTTGCAAGTCCTGTAACT
                      ____________________________________________________________
consensus TGGATCATGGATGACCCGGAAGACTACTCAGAACCCAAAGGATTTGCAAGTCCTGTAACT
 
. : . : . : . : . : . :
rJMFF040H09+ CCAAGTAGTAAGAGATCTTGGAAGTACAATGGAAATGCTTCCAGTCCTTGGTCGTCCTCA
rJMFF029F17+ CCAAGTAGTAAGAGATCTTGGAAGTACAATGGAAATGCTTCCAGTCCTTGGTCGTCCTCA
rJMFF015J04+ CCAAGTAGTAAGAGATCTTGGAAGTACAATGGAAATGCTTCCAGTCCTTGGTCGTCCTCA
                      ____________________________________________________________
consensus CCAAGTAGTAAGAGATCTTGGAAGTACAATGGAAATGCTTCCAGTCCTTGGTCGTCCTCA
 
. : . : . : . : . : . :
rJMFF040H09+ AGAAAGTCCCATAAGCTTAACTATAGTCATTCATCTTCTAGTGCTTCAGCCAAAGGCATC
rJMFF029F17+ AGAAAGTCCCATAAGCTTAACTATAGTCATTCATCTTCTAGTGCTTCAGCCAAAGGCATC
rJMFF015J04+ AGAAAGTCCCATAAGCTTAACTATAGTCATTCATCTTCTAGTGCTTCAGCCAAAGGCATC
                      ____________________________________________________________
consensus AGAAAGTCCCATAAGCTTAACTATAGTCATTCATCTTCTAGTGCTTCAGCCAAAGGCATC
 
. : . : . : . : . : . :
rJMFF040H09+ CACCATAGGTTTTCTGCCTCCCGATTTGGCAACAGTAGTCATGGTGGGACAAGAAACCAT
rJMFF029F17+ CACCATAGGTTTTCTGCCTCCCGATTTGGCAACAGTAGTCATGGTGGGACAAGAAACCAT
rJMFF015J04+ CACCATAGGCTTTCTGCCTCCCGATTTGGCAACAGTAGTCATGGTGGGACAAGAAACCAT
                      ____________________________________________________________
consensus CACCATAGGTTTTCTGCCTCCCGATTTGGCAACAGTAGTCATGGTGGGACAAGAAACCAT
 
. : . : . : . : . : . :
rJMFF040H09+ GATTGGTAGCAGAATGCCTGTTCCTCTTGGTAAACCATAAATGGGCAGGCTGTTGCATAT
rJMFF029F17+ GATTGGTAGCAGAATGCCTGTTCCTCTTGGTAAACCATAAATGGGCAGGCTGTTGCATAT
rJMFF015J04+ GATTGGTAGCAGAATGCCTGTTCCTCTTGGTAAACCATAAATGGGCAGGCTGTTGCATAT
                      ____________________________________________________________
consensus GATTGGTAGCAGAATGCCTGTTCCTCTTGGTAAACCATAAATGGGCAGGCTGTTGCATAT
 
. : . : . : . : . : . :
rJMFF040H09+ GCACTCTGGGGTGGGGGGTTGGTATCTGAATGATCAATGGTATTTTTGAGTTTGCATGTT
rJMFF029F17+ GCACTCTGGGGTGGGGGGTTGGTATCTGAATGATCAATGGTATTTTTGAGTTTGCATGTT
rJMFF014B16+ TGGGGTGGGGGGTTGGTATCNGAATGATCAATGGTATTNNNGAGNNNGCATGTC
rJMFF015J04+ GCACTCTGGGGTGGGGGGTTGGTATCTGAATGATCAATGGTATTTTTGAGTTTGCATGTT
                      ____________________________________________________________
consensus GCACTCTGGGGTGGGGGGTTGGTATCTGAATGATCAATGGTATTTTTGAGTTTGCATGTT
 
. : . : . : . : . : . :
rJMFF040H09+ GACTCGTAAGAGTTGGGTGAAAGACCGTATGCACCCGGTGTGCCGATTACATTTCACAAG
rJMFF029F17+ GACTCGTAAGAGTTGGGTGAAAGACCGTATGCACCCGGTGTGCCGATTACATTTCACAAG
rJMFF014B16+ GACTCGTAAGAGTNGGGTGAAAGNCCGTATGCACCCGGTGTGCCGATTACATTTCACAAG
rJMFF015J04+ GACTCGTAAGAGTTGGGTGAAAGACCGTATGCACCCGGTGTGCCGATTACATTTCACAAG
                      ____________________________________________________________
consensus GACTCGTAAGAGTTGGGTGAAAGACCGTATGCACCCGGTGTGCCGATTACATTTCACAAG
 
. : . : . : . : . : . :
rJMFF040H09+ ATTTAGTCACGTCTTGTAGCCCGTGTTGTTTATGCTGGCGATTGTAACTTATAGGGTACC
rJMFF029F17+ ATTTAGTCACGTCTTGTAGCCCGTGTTGTTTATGCTGGCGATTGTAACTTATAGGGTACC
rJMFF014B16+ ATTTAGTCACGTCTTGTAGCCCGTGTTGTNTATGCTGGNGATTGTAACTTATAGGGTACC
rJMFF015J04+ ATTTAGTCACGTCTTGTAGCCCGTGTTGTTTATGCTGGCGATTGTAACTTATAGGGTACC
                      ____________________________________________________________
consensus ATTTAGTCACGTCTTGTAGCCCGTGTTGTTTATGCTGGCGATTGTAACTTATAGGGTACC
 
. : . : . : . : . : . :
rJMFF040H09+ CTTATGTTTTCCCTTGCAAAAGAAGGATCTTCTGTGTTCCTTTTGTTTTAATTTTTTCAT
rJMFF029F17+ CTTATGTTTTCCCTTGCAAAAGAAGGATCTTCTGTGTTCCTTTTGTTTTAATTTTTTCAT
rJMFF014B16+ CTTATGTTTTCCCTTGCAAAAGAAGGATCTTCTGTGTTCCTTTTGTTTTAATTTTTTCAT
rJMFF015J04+ CTTATGTTTTCCCTTGCAAAAGAAGGATCTTCTGTGTTCCTTTTGTTTTAATTTTTTCAT
                      ____________________________________________________________
consensus CTTATGTTTTCCCTTGCAAAAGAAGGATCTTCTGTGTTCCTTTTGTTTTAATTTTTTCAT
 
. : . : . : . : . : . :
rJMFF040H09+ ATGTTATAGTCATACATGAACCATTGTAAT
rJMFF029F17+ ATGTTATAGTCATACATGAACCATTGTAAT
rJMFF014B16+ ANGTTATAGTCATACATGAACCATTGTAAT
rJMFF015J04+ ATGTTATAGTCATACATGAACCATTGTAATCTGCGGGAGTTCGCTTGCAGTAANGAAAAT
                      ____________________________________________________________
consensus ATGTTATAGTCATACATGAACCATTGTAATCTGCGGGAGTTCGCTTGCAGTAANGAAAAT