Previous Contig 008926:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I17Sequence579008926 (6)pir|T45938|T459382e-32hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido546008926 (6)pir|T45938|T459382e-32hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido
JMSF002J20Sequence348008926 (6)pir|T45938|T459386e-24hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido540008926 (6)pir|T45938|T459382e-32hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido
JMSF016L14Sequence227008926 (6)pir|T45938|T459385e-05hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido541008926 (6)pir|T45938|T459382e-32hypothetical protein F5K20.280 - Arabidopsis thaliana>gb:ATF5K20_1550802 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF002J20- TTT
JMFF015I17+ GTGGAAATCATCTTAATTATTATTGCACATACATACATAGTTT
rJMSF016L14- TTT
rJMFF015I17- TTT
                      ____________________________________________________________
consensus GTGGAAATCATCTTAATTATTATTGCACATACATACATAGTTT
 
. : . : . : . : . : . :
rJMSF002J20- GCCCAAGAAGGGCATGCATAACATAATTTACGTTCATAATCAACCCAAGAAACTTGTTTT
JMFF015I17+ GCCCAAGAAGGGCATGCATAACATAATTTACGTTCATAATCAACCCAAGAAACTTGTTTT
rJMSF016L14- GCCCAAGAAGGGCATGCATAACATAATTTACGTTCATAATCAACCCAAGAAACTTGTTTT
rJMFF015I17- GCCCAAGAAGGGCATGCATAACATAATTTACGTTCATAATCAACCCAAGAAACTTGTTTT
                      ____________________________________________________________
consensus GCCCAAGAAGGGCATGCATAACATAATTTACGTTCATAATCAACCCAAGAAACTTGTTTT
 
. : . : . : . : . : . :
rJMSF002J20- CAGTTCATGCATGCATATCACCAATCCAGCAACTAATTAATAAAACCCATTTTTGCAGGT
JMFF015I17+ CAGTTCATGCATGCATATCACCAATCCAGCAACTAATTAATAAAACCCATTTTTGCAGGT
rJMSF016L14- CAGTTCATGCATGCATATCACCAATCCAGCAACTAATTAATAAAACCCATTTTTGCAGGT
rJMFF015I17- CAGTTCATGCATGCATATCACCAATCCAGCAACTAATTAATAAAACCCATTTTTGCAGGT
                      ____________________________________________________________
consensus CAGTTCATGCATGCATATCACCAATCCAGCAACTAATTAATAAAACCCATTTTTGCAGGT
 
. : . : . : . : . : . :
rJMSF002J20- GATTTATTCAACCCGAGGCTGCACTCATGGCAGGGTATATGGTCCGCATTTGTAGCCGAT
JMFF015I17+ GATTTATTCAACCCGAGGCTGCACTCATGGCAGGGTATATGGTCCGCATTTGTAGCCGAT
rJMSF016L14- GATTTATTCAACCCGAGGCTGCACTCATGGCAGGGTATATGGTCCGCATTTGTAGCCGAT
rJMFF015I17- GATTTATTCAACCCGAGGCTGCACTCATGGCAGGGTATATGGTCCGCATTTGTAGCCGAT
                      ____________________________________________________________
consensus GATTTATTCAACCCGAGGCTGCACTCATGGCAGGGTATATGGTCCGCATTTGTAGCCGAT
 
. : . : . : . : . : . :
rJMSF002J20- GGGGCGGTTGGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
JMSF002J20+ GGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
JMFF015I17+ GGGGCGGTTGGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
rJMSF016L14- GGGGCGGTTGGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
rJMFF015I17- GGGGCGGTTGGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
                      ____________________________________________________________
consensus GGGGCGGTTGGCGAGGTTGCAGCGCTTGGGGATGGTAATGCCGGCTTCGGGCTTCACGCC
 
. : . : . : . : . : . :
rJMSF002J20- GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
JMSF002J20+ GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
JMFF015I17+ GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
rJMSF016L14- GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
rJMFF015I17- GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
                      ____________________________________________________________
consensus GGAGCTCTTGGCCATGTCGGAGAAGAGGACGGCGCAGAGGCAGCCCGGGTTCTGGCTGAA
 
. : . : . : . : . : . :
rJMSF002J20- CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
JMSF002J20+ CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
JMFF015I17+ CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
rJMSF016L14- CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
JMSF016L14+ TGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCNTGCGCCGCCGC
rJMFF015I17- CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
                      ____________________________________________________________
consensus CTTCTTCACCTGAAAGCAGCAGCTGCTGGAAACCGCCGCCTTCGCGTCCTGCGCCGCCGC
 
. : . : . : . : . : . :
rJMSF002J20- CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
JMSF002J20+ CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
JMFF015I17+ CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
rJMSF016L14- CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
JMSF016L14+ CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
rJMFF015I17- CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
                      ____________________________________________________________
consensus CGCACACGGCAGCAGCTTTATGGCCTCGTCGTCTGGAGATGAGTCCCCGCATGGCCCCGC
 
. : . : . : . : . : . :
rJMSF002J20- CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
JMSF002J20+ CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
JMFF015I17+ CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
rJMSF016L14- CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
JMSF016L14+ CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
rJMFF015I17- CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
                      ____________________________________________________________
consensus CGCTTCCACGCTCACTGCTCCTAGAACACACACCATAACAAGAAAACCAACAAAAACCTT
 
. : . : . : . : . : . :
rJMSF002J20- CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCAC
JMSF002J20+ CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCAC
JMFF015I17+ CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCACT
rJMSF016L14- CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCACT
JMSF016L14+ CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCACT
rJMFF015I17- CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCACTCGGT
                      ____________________________________________________________
consensus CAATGGTGCCTCCATTTTTAATCTTTAGATATATATATCACACTCTACACCGCACTCGGT