Previous Contig 008924:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015I03Sequence601000796 (2)pir|H96815|H968156e-35hypothetical protein F9K20.26 [imported] - Arabidopsis thaliana>gb:AE005173_8953733008924 (2)pir|H96815|H968158e-38hypothetical protein F9K20.26 [imported] - Arabidopsis thaliana>gb:AE005173_8953
JMFF021D14Sequence606000796 (2)pir|H96815|H968156e-35hypothetical protein F9K20.26 [imported] - Arabidopsis thaliana>gb:AE005173_8953721008924 (2)pir|H96815|H968157e-42hypothetical protein F9K20.26 [imported] - Arabidopsis thaliana>gb:AE005173_8953

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF021D14+ AGCTCCCCAACTGG
rJMFF015I03+ GCTCCCCAACTGG
                      ____________________________________________________________
consensus AGCTCCCCAACTGG
 
. : . : . : . : . : . :
rJMFF021D14+ CAGGACCCCCAGAAT-AAGAACTGATTGGAATGGCCCTTCTGCCTGTGTTGGCTGGGGTG
rJMFF015I03+ CAGGACCCCCAGAATAAAGAACTGATTGGAATGGCCCTTCTGCCTGTGTTGGCTGGGGTG
                      ____________________________________________________________
consensus CAGGACCCCCAGAATAAAGAACTGATTGGAATGGCCCTTCTGCCTGTGTTGGCTGGGGTG
 
. : . : . : . : . : . :
rJMFF021D14+ GACCACACTACTCTTTCCTTCCTTCATCGACACCTGTAAGCCCTAGCCGCCAGACCCATC
rJMFF015I03+ GACCACACTACTCTTTCCTTCCTTCATCGACACCTGTAAGCCCTAGCCGCCAGACCCATC
                      ____________________________________________________________
consensus GACCACACTACTCTTTCCTTCCTTCATCGACACCTGTAAGCCCTAGCCGCCAGACCCATC
 
. : . : . : . : . : . :
rJMFF021D14+ CTCCTCATTCAGAATGGCTTGCTGGGATACAAATCCCACATGGTGGGGCAACTTCTCCAA
rJMFF015I03+ CTCCTCATTCAGAATGGCTTGCTGGGATACAAATCCCACATGGTGGGGCAACTTCTCCAA
                      ____________________________________________________________
consensus CTCCTCATTCAGAATGGCTTGCTGGGATACAAATCCCACATGGTGGGGCAACTTCTCCAA
 
. : . : . : . : . : . :
rJMFF021D14+ CTTATAGTCTTGTCTCTCCCAATCCACTCGGCTTTAAAGCCCAGACTCTGCCCCATCATC
rJMFF015I03+ CTTATAGTCTTGTCTCTCCCAATCCACTCGGCTTTAAAGCCCAGACTCTGCCCCATCATC
                      ____________________________________________________________
consensus CTTATAGTCTTGTCTCTCCCAATCCACTCGGCTTTAAAGCCCAGACTCTGCCCCATCATC
 
. : . : . : . : . : . :
rJMFF021D14+ GCGGATCTCTCATTTCCACTCCTGGACAGAGTGGGACATGTTCACCTGCTATTGCCGCAG
rJMFF015I03+ GCGGATCTCTCATTTCCACTCCTGGACAGAGTGGGACATGTTCACCTGCTATTGCCGCAG
                      ____________________________________________________________
consensus GCGGATCTCTCATTTCCACTCCTGGACAGAGTGGGACATGTTCACCTGCTATTGCCGCAG
 
. : . : . : . : . : . :
rJMFF021D14+ GCTTTGATCACACTGCTGACGTTCCAATGGCTGAAGCTGTCTCAGACGAATTTGCATTTG
rJMFF015I03+ GCTTTGATCACACTGCTGACGTTCCAATGGCTGAAGCTGTCTCAGACGAATTTGCATTTG
                      ____________________________________________________________
consensus GCTTTGATCACACTGCTGACGTTCCAATGGCTGAAGCTGTCTCAGACGAATTTGCATTTG
 
. : . : . : . : . : . :
rJMFF021D14+ GGAGCAACACAGCAGGCTTTGTGAAGCCCTGGGAAGGGGAGAGGATTCACGAGGAGTGTG
rJMFF015I03+ GGAGCAACACAGCAGGCTTTGTGAAGCCCTGGGAAGGGGAGAGGATTCACGAGGAGTGTG
                      ____________________________________________________________
consensus GGAGCAACACAGCAGGCTTTGTGAAGCCCTGGGAAGGGGAGAGGATTCACGAGGAGTGTG
 
. : . : . : . : . : . :
rJMFF021D14+ GTCCTGATGACCTCGAGCTCACTCTCGGGAGCTCTAAGACCAGGTGAAGATTGAGAATGG
rJMFF015I03+ GTCCTGATGACCTCGAGCTCACTCTCGGGAGCTCTAAGACCAGGTGAAGATTGAGAATGG
                      ____________________________________________________________
consensus GTCCTGATGACCTCGAGCTCACTCTCGGGAGCTCTAAGACCAGGTGAAGATTGAGAATGG
 
. : . : . : . : . : . :
rJMFF021D14+ AACAAAAACACAAGTTGTGTGGATGTGATAACTGAATTAAAGACAAGATGTTGAGACAAG
rJMFF015I03+ AACAAAAACACAAGTTGTGTGGATGTGATAACTGAATTAAAGACAAGATGTTGAGACAAG
                      ____________________________________________________________
consensus AACAAAAACACAAGTTGTGTGGATGTGATAACTGAATTAAAGACAAGATGTTGAGACAAG
 
. : . : . : . : . : . :
rJMFF021D14+ AAAGACATCACCTGGATGAACATGCGGCTGTCTAAGCTGCTATCCAACATGTTTCATGGT
rJMFF015I03+ AAAGACATCACCTGGATGAACATGCGGCTGTCTAAGCTGCTATCCAACATGTTTCATGGT
                      ____________________________________________________________
consensus AAAGACATCACCTGGATGAACATGCGGCTGTCTAAGCTGCTATCCAACATGTTTCATGGT
 
. : . : . : . : . : . :
rJMFF021D14+ TTGTTGTATTCGTATGTTCTTCCTAAGTCTACCCACCCCTCCACCTCCAGACATTTTCTT
rJMFF015I03+ TTGTTGTATTCGTATGTTCTTCCTAAGTCTACCCACCCCTCCACCTCCAGACATTTTCTT
                      ____________________________________________________________
consensus TTGTTGTATTCGTATGTTCTTCCTAAGTCTACCCACCCCTCCACCTCCAGACATTTTCTT
 
. : . : . : . : . : . :
rJMFF021D14+ TCTTGCATTATTATGTAAATTTC-TTCAGGTTGCACTCATTTAACTATA
rJMFF015I03+ TCTTGCATTATTATGTAAATTTCTTTCAGGTTGCACTCATTTAACTATATATTACGGAGT
                      ____________________________________________________________
consensus TCTTGCATTATTATGTAAATTTCTTTCAGGTTGCACTCATTTAACTATATATTACGGAGT